/ Language: Русский / Genre:auto_regulations

КоАП для автомобилистов с комментариями

Екатерина Федорова

В этой книге собраны важнейшие для каждого автовладельца статьи КоАП РФ с учетом самых последних изменений.Автоюрист подробно и в доступной форме комментирует текст Кодекса, приводя ссылки на действующие нормативные акты.Небольшой формат позволит всегда держать издание под рукой, а актуальная информация будет полезна водителю в любой ситуации.Книга учитывает изменения в КОАП, которые вступают в силу 1 января и 1 июля 2012 года.

Е. Н. Федорова

КоАП для автомобилистов с комментариями. C изменениями на 2012 год

Предисловие

Эта книга будет чрезвычайно полезна и интересна всем без исключения автолюбителям. Она станет вашим незаменимым спутником и помощником в дороге. В ней представлен текст Кодекса РФ об административных правонарушениях в действующей редакции с учетом последних важных изменений, вступивших в силу 21 ноября 2010 г.

В комментариях к статьям в доступной форме и со ссылкой на действующие нормативные акты изложены самые важные моменты: какие именно действия водителя могут считаться нарушением Кодекса и ПДД, а какие таковыми не являются и не подлежат наказанию. Вы узнаете, как вести себя с сотрудником ГИБДД, каким образом построить линию защиты, чтобы избежать несправедливого наказания.

Вам не нужно больше искать правовой материал, регламентирующий отношения в области дорожного движения, – он весь собран в этой книге.

Административное правонарушение и административная ответственность

Статья 2.6.1. Административная ответственность собственников (владельцев) транспортных средств

1. К административной ответственности за административные правонарушения в области дорожного движения в случае их фиксации работающими в автоматическом режиме специальными техническими средствами, имеющими функции фото– и киносъемки, видеозаписи, или средствами фото– и киносъемки, видеозаписи привлекаются собственники (владельцы) транспортных средств.

2. Собственник (владелец) транспортного средства освобождается от административной ответственности, если в ходе рассмотрения жалобы на постановление по делу об административном правонарушении, вынесенное в соответствии с частью 3 статьи 28.6 настоящего Кодекса, будут подтверждены содержащиеся в ней данные о том, что в момент фиксации административного правонарушения транспортное средство находилось во владении или в пользовании другого лица либо к данному моменту выбыло из его обладания в результате противоправных действий других лиц.

С июля 2008 г. в России разрешено фиксировать нарушения Правил дорожного движения (далее – ПДД) с помощью технических средств, работающих в автоматическом режиме.

Это может быть фото– и видеозапись, киносъемка. Системы видеофиксации нарушений ПДД могут быть как стационарными, так и передвижными. Причем, согласно российскому законодательству, предупреждать водителя о наличии таких фиксирующих устройств никто не обязан. Зафиксированное нарушение автоматически передается по каналам связи в центр обработки информации, а также на посты ДПС, оборудованные соответствующими приборами.

После получения данных с камеры компьютер автоматически распечатает постановление, где будет фотография автомобиля с четко видимым госномером, указаны вид правонарушения, место его совершения, данные о транспортном средстве (далее – ТС), фамилия, имя, отчество владельца ТС, размер штрафа. Копию этого постановления вам обязаны выслать в течение трех дней со дня его вынесения. Такое постановление высылается с уведомлением о вручении, в его получении вы должны будете расписаться. Обратите внимание на то, насколько четко виден госномер автомобиля, – не допускается неоднозначное прочтение цифр и букв. Если вы заметили, что не все цифры и буквы ясно видны, то это, безусловно, основание для обжалования такого постановления.

Данная статья внесла некоторые коррективы в трактовку понятия «презумпция невиновности», прописанного в ст. 1.5 Кодекса Российской Федерации об административных правонарушениях (далее – КоАП РФ). Теперь, если правонарушение зафиксировано специальными техническими средствами, обязанность доказывать свою невиновность лежит на лице, привлекаемом к административной ответственности. Получается, если придорожная видеокамера фиксирует нарушение, номер вашей машины, штраф будет автоматически выписан именно вам как владельцу и прислан на адрес вашей регистрации. Если за рулем автомобиля в момент правонарушения вас не было и вы считаете наказание несправедливым, то нужно подать жалобу на постановление в течение 10 дней с момента его получения. И обязанность доказать, что в момент нарушения за рулем находились не вы, поскольку передали свою машину по доверенности другому человеку или машиной завладели противозаконными способами, будет лежать уже на вас.

С 2012 года текст п. 1 ст. 2.6.1 будет дополнен: «К административной ответственности за административные правонарушения в области дорожного движения и административные правонарушения в области благоустройства территории, предусмотренные законами субъектов Российской Федерации, совершенные с использованием транспортных средств, в случае фиксации этих административных правонарушений работающими в автоматическом режиме специальными техническими средствами, имеющими функции фото– и киносъемки, видеозаписи, или средствами фото– и киносъемки, видеозаписи привлекаются собственники (владельцы) транспортных средств».

Статья 2.7. Крайняя необходимость

Не является административным правонарушением причинение лицом вреда охраняемым законом интересам в состоянии крайней необходимости, то есть для устранения опасности, непосредственно угрожающей личности и правам данного лица или других лиц, а также охраняемым законом интересам общества или государства, если эта опасность не могла быть устранена иными средствами и если причиненный вред является менее значительным, чем предотвращенный вред.

Кодекс предусматривает ряд исключений, при которых совершивший правонарушение человек освобождается от административной ответственности. Согласно п. 3 ч. 1 ст. 24.5 КоАП РФ, если вы совершили определенные действия в состоянии крайней необходимости, производство по делу об административном правонарушении не может быть начато, а начатое производство подлежит прекращению.

Но чтобы подпасть под действие статьи о крайней необходимости и освободиться от административной ответственности именно по этому основанию, нужно соблюсти несколько условий:

• опасность, которая угрожает личности, ее правам, интересам общества и государства, должна быть непосредственной, то есть угрожающей именно в данный момент времени;

• угрожающая опасность не может быть устранена другими средствами;

• причиненный вред должен быть меньшим, чем предотвращенный вред. Причем жизнь человека и его здоровье стоят в иерархии ценностей на первом месте.

Можно привести такой пример. Вам необходимо доставить беременную жену, у которой начались роды, в роддом, и вы, конечно, уже почти не обращаете внимания на знаки, ограничивающие скорость. Но вот вас останавливает сотрудник ГИБДД, который намерен наказать за превышение скорости. Постарайтесь спокойно объяснить ему, что такие ваши действия – состояние крайней необходимости. Здоровью жены и ребенка угрожает опасность, необходима срочная помощь врачей. А скорую помощь пришлось бы ждать очень долго (например, из ближайшего населенного пункта, расстояние до которого километров 20–30). Вот вы и решили сами доставить жену в больницу, что будет гораздо быстрее. Тем более что эти действия никакого ущерба никому не причинили, вы не создали аварийной ситуации. Все три условия признания крайней необходимости ваших действий соблюдены, и сотрудник ГИБДД, скорее всего, пойдет навстречу и не станет составлять протокол о привлечении к административной ответственности. Но если это произошло, то при обжаловании протокола и постановления о привлечении вас к административной ответственности заручитесь либо свидетельскими показаниями врачей, либо документом (справкой) о том, что промедление в доставке жены в роддом повлекло бы за собой вред здоровью ее и ребенка, а также поставило бы их жизни под угрозу.

Статья 2.9. Возможность освобождения от административной ответственности при малозначительности административного правонарушения При малозначительности совершенного административного правонарушения судья, орган, должностное лицо, уполномоченные решить дело об административном правонарушении, могут освободить лицо, совершившее административное правонарушение, от административной ответственности и ограничиться устным замечанием.

Малозначительность правонарушения – это еще одна возможность избежать административной ответственности. Норма данной статьи дает возможность должностному лицу, судье ограничиться лишь устным замечанием и освободить нарушителя от административной ответственности.

Пленум Верховного Суда РФ в своем постановлении от 24.03.2005 № 5 (п. 21) раскрыл понятие малозначительности административного правонарушения: «Малозначительным административным правонарушением является действие или бездействие, хотя формально и содержащее признаки состава административного правонарушения, но с учетом характера совершенного правонарушения и роли правонарушителя, размера вреда и тяжести наступивших последствий не представляющее существенного нарушения охраняемых общественных правоотношений». В самом же Кодексе понятие малозначительности не расшифровано – все решается сотрудником ГИБДД. Поэтому иногда за непристегнутый ремень вы можете отделаться замечанием, а иногда получить положенный по ст. 12.6 КоАП РФ штраф.

Но обязанность доказывать малозначительность своего деяния в суде при обжаловании постановления о привлечении к административной ответственности уже будет лежать на вас, что, в принципе, не очень просто, так как формально состав правонарушения есть. Но если вам удастся доказать его малозначительность, то на основании п. 3 ч. 1 ст. 30.7 КоАП РФ суд или вышестоящее должностное лицо примет решение об отмене постановления и о прекращении производства по делу. Вам вынесут устное замечание, которое не является административным наказанием, в отличие от предупреждения, и не учитывается при назначении наказания за совершенное в течение года повторное однородное административное правонарушение.

Административные правонарушения в области дорожного движения

Статья 12.1. Управление транспортным средством, не зарегистрированным в установленном порядке, транспортным средством, не прошедшим государственного технического осмотра

1. Управление транспортным средством, не зарегистрированным в установленном порядке, влечет наложение административного штрафа в размере от трехсот до восьмисот рублей.

2. Управление транспортным средством, не прошедшим государственного технического осмотра, влечет наложение административного штрафа в размере от пятисот до восьмисот рублей.

Примечания .

1. Под транспортным средством в настоящей статье следует понимать автомототранспортное средство с рабочим объемом двигателя более 50 кубических сантиметров и максимальной конструктивной скоростью более 50 километров в час, а также прицепы к нему, подлежащие государственной регистрации, а в других статьях настоящей главы также трактора, другие самоходные дорожно-строительные и иные машины, трамваи, троллейбусы.

2. Порядок и сроки прохождения государственного технического осмотра устанавливаются федеральным законом.

Порядок регистрации ТС установлен Постановлением Правительства РФ от 12.08.1994 № 938 «О государственной регистрации автомототранспортных средств и других видов самоходной техники на территории РФ».

В данной статье, исходя из текста примечания, речь идет только о ТС с рабочим объемом двигателя более 50 кубических сантиметров и максимальной конструктивной скоростью более 50 километров в час, а также прицепах к ним, подлежащих государственной регистрации.

При назначении штрафа, сумма которого может варьироваться от минимального до максимального предела, должны учитываться как смягчающие, так и отягчающие административную ответственность обстоятельства. В ст. 4.2 КоАП РФ содержится перечень смягчающих обстоятельств, но этот перечень не закрытый. Дается право должностному лицу или судье, рассматривающему дело об административном правонарушении, признать смягчающими обстоятельствами и те, которые не указаны в Кодексе и законах субъектов Российской Федерации об административном правонарушении. Судья, сотрудник ГИБДД или должностное лицо ГИБДД при рассмотрении дела могут учесть и ваше материальное положение, и раскаяние в совершенном правонарушении, и то, что вы совершили нарушение впервые. Но если вы едете на автомобиле, который не зарегистрирован, да еще и без прохождения техосмотра, то получается, что совершаете сразу два правонарушения, а за это штраф назначается уже по верхнему пределу согласно ч. 2 ст. 4.4 КоАП РФ, то есть составит 800 рублей.

Если говорить о правонарушении, предусмотренном ч. 2 ст. 12.1 (управление ТС, не прошедшим государственный технический осмотр), то дело обстоит гораздо сложнее.

Здесь уже вступает в силу ст. 27.13 КоАП РФ, которая запрещает эксплуатацию ТС, не прошедшего техосмотра. Причем номерные знаки с вашего автомобиля будут сняты и оставлены на хранение в подразделении ГИБДД.

Согласно п. 144 Административного регламента от 01.09.2009 (далее – Административный регламент) сотрудник ГИБДД составляет протокол об административном правонарушении по ч. 2 ст. 12.1 КоАП РФ, после этого запрещает эксплуатацию автомобиля путем внесения записи в уже выписанный протокол или путем составления другого протокола. Сотрудник ГИБДД обязан выдать вам копию протокола, который необходимо подписать. Если вы не согласны подписывать протокол, то отказ должен быть зафиксирован в присутствии двух понятых.

Номерные знаки сотрудник ГИБДД должен сначала предложить вам снять самому и только после отказа имеет право это сделать лично. Правила хранения и выдачи номерных знаков регламентируются Приказом МВД РФ от 19.03.2004 № 187. В органах ГИБДД ведется реестр снятых номерных знаков. Если их сняли на территории не того субъекта Российской Федерации, где зарегистрирован ваш автомобиль, то они должны быть переданы в органы ГИБДД по месту учета автомобиля. Но если вам это неудобно по каким-то причинам, можете обратиться с ходатайством в орган ГИБДД, на территории которого были сняты государственные регистрационные знаки с вашего автомобиля, чтобы их не направляли по месту учета. Выдача номерных знаков проходит после устранения причины их снятия, то есть вы должны будете предъявить талон о прохождении техосмотра.

Следует напомнить, что без прохождения государственного технического осмотра эксплуатация ТС после регистрации в ГИБДД или иных органах, определяемых Правительством Российской Федерации, допускается в течение 30 суток. В случае возникновения непредвиденных обстоятельств (болезнь, командировка и др.) этот срок продлевается при условии предъявления документов, подтверждающих указанные обстоятельства.

С 1 января 2012 года ч. 2 будет переформулирована: «Управление легковым такси, автобусом или грузовым автомобилем, предназначенным и оборудованным для перевозок людей, с числом мест для сидения более чем восемь (кроме места для водителя), специализированным транспортным средством, предназначенным и оборудованным для перевозок опасных грузов, которые не прошли государственный технический осмотр или технический осмотр », а Примечание 2 – упразднено.

Статья 12.2. Управление транспортным средством с нарушением правил установки на нем государственных регистрационных знаков

1. Управление транспортным средством с нечитаемыми, нестандартными или установленными с нарушением требований государственного стандарта государственными регистрационными знаками, за исключением случаев, предусмотренных частью 2 настоящей статьи, влечет предупреждение или наложение административного штрафа в размере пятисот рублей.

2. Управление транспортным средством без государственных регистрационных знаков, а равно управление транспортным средством без установленных на предусмотренных для этого местах государственных регистрационных знаков либо управление транспортным средством с государственными регистрационными знаками, оборудованными с применением материалов, препятствующих или затрудняющих их идентификацию, влечет наложение административного штрафа в размере пяти тысяч рублей или лишение права управления транспортными средствами на срок от одного до трех месяцев.

3. Установка на транспортном средстве заведомо подложных государственных регистрационных знаков влечет наложение административного штрафа на граждан в размере двух тысяч пятисот рублей; на должностных лиц, ответственных за эксплуатацию транспортных средств, – от пятнадцати тысяч до двадцати тысяч рублей; на юридических лиц – от четырехсот тысяч до пятисот тысяч рублей.

4. Управление транспортным средством с заведомо подложными государственными регистрационными знаками влечет лишение права управления транспортными средствами на срок от шести месяцев до одного года.

Примечание.

Государственный регистрационный знак признается нестандартным, если он не соответствует требованиям, установленным в соответствии с законодательством о техническом регулировании, и нечитаемым, если с расстояния 20 метров не обеспечивается прочтение в темное время суток хотя бы одной из букв или цифр заднего государственного регистрационного знака, а в светлое время суток хотя бы одной из букв или цифр переднего или заднего государственного регистрационного знака.

С целью правильного понимания и однозначной трактовки понятий из ч. 1 ст. 12.2 КоАП РФ «нечитаемость», «нестандартность» знака, а также «установка с нарушением требования государственного стандарта» необходимо обратиться к ГОСТу Р 50577-93 «Государственный стандарт Российской Федерации. Знаки государственные регистрационные транспортных средств», к которому и отсылает нас КоАП РФ. Согласно приложению 3 (п. 3.4.7) данного ГОСТа «Регистрационный знак должен устанавливаться таким образом, чтобы в темное время суток обеспечивалось его прочтение с расстояния не менее 20 метров при освещении штатным фонарем (фонарями) знака транспортного средства.

Примечание. Требование не распространяется на надписи „RUS” и „Транзит”, а также изображение Государственного флага Российской Федерации».

Отсюда исходит и законодатель в определении понятия «нечитаемый государственный регистрационный знак», изложенного в примечании к ст. 12.2 КоАП РФ.

Нестандартными признаются знаки, которые не соответствуют требованиям ГОСТа Р 50577-93 по размеру, форме, цвету и другим параметрам.

Если ранее при остановке автомобиля по причине нечитаемости номеров сотрудник ГИБДД мог предложить вам просто протереть номера и ехать дальше, то теперь, когда штраф за это правонарушение уже 500 рублей, дело может закончиться составлением протокола. В своих объяснениях к протоколу вы можете указать, что дорожное покрытие сильно загрязнено, это и послужило причиной нечитаемости номера. Можете также пригласить двух свидетелей, если считаете, что номера автомобиля читаемые, и не согласны с вынесенным наказанием. Свидетели могут подтвердить факт читаемости номеров, что должно быть занесено в протокол.

Если после регистрации своего ТС вы не установили номера и ездите без них (а номера лежат, например, в багажнике), то рискуете получить административное взыскание по ч. 2 ст. 12.2 КоАП РФ. Сейчас в сферу действия ч. 2 ст. 12.2 КоАП РФ попали действия по управлению ТС, на котором госзнаки оборудованы с применением материалов, препятствующих или затрудняющих их идентификацию. Сюда относятся и так называемые решетки на номерных знаках.

Это правонарушение может быть рассмотрено как в органах ГИБДД (наказание в виде штрафа), так и передано на рассмотрение мировому судье (наказание в виде лишения права управления транспортным средством). При назначении наказания будут учитываться смягчающие и отягчающие административную ответственность обстоятельства.

Если вы ездите без одного госномера (предположим, вы его потеряли или он был украден), то такие действия подпадают под ч. 1 ст. 12.1 КоАП РФ. В этом случае Верховный Суд РФ свою позицию относительно квалификации такого правонарушения определил следующим образом: « КоАП РФ предусматривает ответственность за управление транспортным средством без государственных регистрационных знаков, то есть без двух (переднего и заднего) номерных знаков. Отсутствие одного из регистрационных знаков при наличии другого, доступного для свободного обозрения, не означает полного отсутствия регистрационных знаков на транспортном средстве и влечет за собой иные предусмотренные законом последствия, связанные с нарушением его владельцем требований к установке регистрационных знаков на транспортном средстве ».

Вы можете быть подвергнуты только наказанию в виде штрафа в размере 500 рублей (ч. 1 ст. 12.2 КоАП РФ). Части 3 и 4 настоящей статьи предусматривают ответственность за установку заведомо подложных государственных регистрационных знаков и управление ТС с заведомо подложными государственными регистрационными знаками. Ключевое слово в данных пунктах – заведомо. Здесь вина может быть только в форме прямого умысла, то есть виновный осознает, что нарушает закон и сознательно идет на это. Доказать вашу вину должно либо должностное лицо ГИБДД, либо суд. Не забывайте, что действует презумпция невиновности.

За управление ТС с заведомо подложными номерами наказанием является лишение права управлять ТС на срок от 6 месяцев до года. Дела по ч. 4 ст. 12.2 рассматриваются исключительно судьями. Если не проводится административное расследование в порядке, предусмотренном ст. 28.7 КоАП РФ, то дело рассматривает мировой судья. Если же расследование необходимо (назначается экспертиза, проводятся иные процессуальные действия, требующие значительных временных затрат), то дело передается в районный (городской) суд.

Статья 12.3. Управление транспортным средством водителем, не имеющим при себе документов, предусмотренных ПДД

1. Управление транспортным средством водителем, не имеющим при себе документов на право управления им, регистрационных документов на транспортное средство, а равно документов, подтверждающих право владения, пользования или распоряжения управляемым им транспортным средством в отсутствие его владельца, влечет предупреждение или наложение административного штрафа в размере ста рублей.

2. Управление транспортным средством водителем, не имеющим при себе талона о прохождении государственного технического осмотра, страхового полиса обязательного страхования гражданской ответственности владельцев транспортного средства, за исключением случая, предусмотренного частью 2 статьи 12.37 настоящего Кодекса, а в случаях, предусмотренных законодательством, – лицензионной карточки, путевого листа или товарно-транспортных документов, влечет предупреждение или наложение административного штрафа в размере ста рублей.

3. Передача управления транспортным средством лицу, не имеющему при себе документов на право управления им, влечет предупреждение или наложение административного штрафа в размере ста рублей.

В данной статье речь идет о том, что водитель именно забыл документы – либо подтверждающие право собственности на автомобиль, либо водительское удостоверение, либо полис ОСАГО и пр. Либо передал управление ТС лицу, которое при себе не имеет таких документов. Но если вы лишены прав и пытаетесь изобразить забывчивость, то такой вариант не пройдет. Сегодня сотрудник ГИБДД через единую компьютерную сеть может проверить, не лишен ли прав водитель, управляющий данным ТС.

На что следует обратить внимание: Регламент действий сотрудников ГИБДД, который вступил в силу 01.09.2009 г., а конкретно его п. 63, говорит, что «проверка документов на право пользования и управления транспортным средством, документов на транспортное средство и перевозимый груз, а также документов, удостоверяющих личность водителя и пассажиров (только на стационарных постах ДПС), является основанием для остановки транспортного средства сотрудником ГИБДД. Иначе говоря, сотрудник ГИБДД вправе проверить ваши документы на автомобиль и документы, удостоверяющие личность (помимо водительского удостоверения), включая документы на перевозимый груз, только на стационарном посту ДПС.

Но вот вы достаете документы, чтобы предъявить их сотруднику ГИБДД, и оказывается, что комплект неполный. В этой ситуации вы должны быть максимально корректны, объяснить причину отсутствия документов, не скандалить. Согласно ч. 1 ст. 27.12 сотрудник ГИБДД может отстранить вас от управления ТС до устранения причин, вызвавших это, а согласно ч. 1 ст. 27.13 КоАП РФ машину могут задержать и направить на штрафстоянку. В этом случае вам придется еще оплатить и услуги эвакуатора. О задержании ТС составляется либо отдельный протокол, либо делается запись в уже составленном протоколе. Но Кодекс об административных правонарушениях РФ предусматривает и такое развитие ситуации, когда вам разрешат двигаться к месту устранения причины запрещения эксплуатации ТС, но не более суток (ч. 2.1 ст. 27.13 КоАП РФ). То есть вам могут разрешить вернуться за документами туда, где вы их забыли, или разрешить родственникам или знакомым привезти их на место остановки ТС (подаете ходатайство на имя сотрудника ГИБДД).

Согласно нормам ст. 12.3 КоАП РФ за отсутствие документов вы можете получить лишь предупреждение. Но, повторюсь еще раз, если вы забыли или потеряли какой-либо документ, постарайтесь найти более-менее внятное объяснение этому и добиться того, чтобы вам разрешили вернуться за недостающими документами. Обычно сотрудники ГИБДД идут навстречу в этой ситуации.

С 1 января 2012 года статья 12.3 КОАП РФ будет звучать по-другому: «Управление транспортным средством водителем, не имеющим при себе документов, предусмотренных Правилами дорожного движения, а также разрешения на осуществление деятельности по перевозке пассажиров и багажа легковым такси » и дополнится ч. 2.1: «Перевозка пассажиров и багажа легковым транспортным средством, используемым для оказания услуг по перевозке пассажиров и багажа, водителем, не имеющим при себе разрешения на осуществление деятельности по перевозке пассажиров и багажа легковым такси, влечет наложение административного штрафа на водителя в размере пяти тысяч рублей ». Это вызвано необходимостью лицензирования легковых такси и более четкого контроля за перевозками людей и багажа легковым транспортным средством. В законодательные акты и федеральные законы вносятся соответствующие изменения, согласно которым все легковые такси, обслуживающие население, обязаны иметь специальное разрешение на осуществление такого вида деятельности, проходить технический осмотр 2 раза в год и иметь специальную цветографическую схему в виде «шашечек». Кроме этого, водителям запрещается осуществлять перевозку людей и багажа с взиманием за это платы, что расценивается, согласно законодательству РФ, как административное правонарушение с последующим взысканием штрафа с водителя в размере 5000 рублей.

Иначе говоря, если вы решили подвезти попутчиков, то в случае остановки вашего автомобиля и выявления данного факта сотрудником ГИБДД, вы будете привлечены к административной ответственности и должны будете оплатить вышеуказанный штраф.

Статья 12.4. Нарушение правил установки на транспортном средстве устройств для подачи специальных световых или звуковых сигналов либо незаконное нанесение специальных цветографических схем автомобилей оперативных служб

1. Установка на передней части транспортного средства световых приборов с огнями красного цвета или световозвращающих приспособлений красного цвета, а равно световых приборов, цвет огней и режим работы которых не соответствуют требованиям Основных положений по допуску транспортных средств к эксплуатации и обязанностей должностных лиц по обеспечению безопасности дорожного движения, влечет наложение административного штрафа на граждан в размере двух тысяч пятисот рублей с конфискацией указанных приборов и приспособлений; на должностных лиц, ответственных за эксплуатацию транспортных средств, – от пятнадцати тысяч до двадцати тысяч рублей с конфискацией указанных приборов и приспособлений; на юридических лиц – от четырехсот тысяч до пятисот тысяч рублей с конфискацией указанных приборов и приспособлений.

2. Установка на транспортном средстве без соответствующего разрешения устройств для подачи специальных световых или звуковых сигналов (за исключением охранной сигнализации) влечет наложение административного штрафа на граждан в размере двух тысяч пятисот рублей с конфискацией указанных устройств; на должностных лиц, ответственных за эксплуатацию транспортных средств, – двадцати тысяч рублей с конфискацией указанных устройств; на юридических лиц – пятисот тысяч рублей с конфискацией указанных устройств.

3. Незаконное нанесение на наружные поверхности транспортного средства специальных цветографических схем автомобилей оперативных служб влечет наложение административного штрафа на граждан в размере двух тысяч пятисот рублей; на должностных лиц, ответственных за эксплуатацию транспортных средств, – двадцати тысяч рублей; на юридических лиц – пятисот тысяч рублей.

В этой статье речь идет именно об установке на ТС ненадлежащих световых приборов, устройств подачи спец-сигналов (звуковых или световых), а также о нанесении цветографических схем. Если вы лишь управляли таким автомобилем, то не можете быть наказаны по этой статье, пока не будет доказано, что именно вы установили ненадлежащие световые приборы или спецсигналы.

Требования к световым приборам, устанавливаемым на ТС, изложены не только в Основных положениях по допуску ТС к эксплуатации и обязанностей должностных лиц по обеспечению безопасности дорожного движения, которые утверждены Постановлением Совета Министров – Правительства Российской Федерации от 23.10.1993 № 1090 (далее – Основные положения).

На территории Российской Федерации действует ГОСТ 8769-75 (CT СЭВ 4122-83) «Приборы внешние световые автомобилей, автобусов, троллейбусов, тракторов, прицепов и полуприцепов. Количество, расположение, цвет, углы видимости». В этом ГОСТе очень подробно регламентировано, какие световые приборы должны устанавливаться на ТС, сколько их должно быть, какой угол видимости они должны создавать. ГОСТ однозначно устанавливает, что фары ближнего и дальнего света должны излучать белый или селективно-желтый свет. Также допускается установка противотуманных фар с белым или селективно-желтым светом. Световые приборы с огнями красного цвета или световозвращающие приспособления красного цвета не должны устанавливаться на передней части автомобиля. Также запрещается использовать любые световые приборы, цвет которых не соответствует ГОСТу и требованиям Основных положений.

Это относится и к ксеноновым фарам. Ксеноновые фары – это фары с газоразрядными источниками света. Они могут быть предусмотрены конструкцией автомобиля, но если вы самовольно внесли изменения в конструкцию фар своего автомобиля, то вас накажут по ч. 1 ст. 12.4 КоАП РФ «применение в фарах, предназначенных для использования с лампами накаливания, в том числе галогенными, газоразрядных источников света следует квалифицировать как несоответствие режима работы внешних световых приборов (совокупность технических характеристик фар, соответствующих тому или иному светораспределению, обеспечивающему безопасность дорожного движения в зависимости от дорожной ситуации и метеоусловий) требованиям конструкции транспортного средства» (разъяснения Департамента обеспечения безопасности дорожного движения МВД России об использовании ксеноновых фар от 20.02.2010).

Пункты 2 и 3 ст. 12.4 КоАП РФ касаются установки без надлежащего разрешения специальных световых и звуковых сигналов, а также нанесения цветографических схем, предназначенных для автомобилей различных оперативных служб. Порядок получения разрешения на установку спец-сигналов закреплен в Приказе от 19.02.2007 № 167 «О выдаче разрешений на установку на транспортных средствах опознавательных знаков, устройств для подачи специальных световых и звуковых сигналов». Наличие разрешения на подачу специальных световых и звуковых сигналов должно быть отражено в свидетельстве о регистрации ТС. Если вы решили сами установить некое подобие мигалки, то будьте готовы понести наказание в виде штрафа с конфискацией данного устройства. То же самое касается и нанесения цветографических схем на автомобиль – о них также в свидетельстве о регистрации ТС делается запись в графе «Цвет».

Дела об административных правонарушениях, предусмотренные ч. 1 и 2 ст. 12.4 КоАП РФ, рассматриваются судьями, а дела, предусмотренные ч. 3 комментируемой статьи, могут рассматривать начальник ГИБДД, его заместитель, командиры полка, батальона, роты ДПС. Субъектами данного правонарушения могут стать не только граждане, но и должностные и юридические лица. Наказанием за правонарушение являются штраф и конфискация указанных устройств. Для юридического лица предусмотрен самый большой размер штрафа – 500 000 рублей. Госномера подлежат снятию, а эксплуатация ТС запрещается согласно ч. 2 ст. 27.13 КоАП РФ.

С 1 января 2012 года статья 12.4 КоАП РФ претерпевает некоторые изменения. В частности, меняются: название статьи «Нарушение правил установки на транспортном средстве устройств для подачи специальных световых или звуковых сигналов либо незаконное нанесение специальных цветографических схем автомобилей оперативных служб, цветографической схемы легкового такси или незаконная установка опознавательного фонаря легкового такси » , часть 2 «Установка на транспортном средстве без соответствующего разрешения устройств для подачи специальных световых или звуковых сигналов (за исключением охранной сигнализации) или незаконная установка на транспортном средстве опознавательного фонаря легкового такси » и часть 3 «Незаконное нанесение на наружные поверхности транспортного средства специальных цветографических схем автомобилей оперативных служб или цветографической схемы легкового такси». Теперь ст. 12.4 КоАП РФ предусматривает также административную ответственность за нанесение на транспортном средстве цветографических схем и установку опознавательного фонаря легкового такси, если автомобиль к данному виду транспортных средств не относится. В этом случае, если водитель, не имея специального разрешения на перевозку людей и багажа, установит на автомобиле опозновательный фонарь («шашечки») и специальную цветографическую схему, то будет привлечен к административной ответственности с последующим наложением штрафа в размере 2500 рублей. Если данное правонарушение совершалось от имени юридического лица, то административный штраф будет налагаться только на юридическое лицо.

Статья 12.5. Управление транспортным средством при наличии неисправностей или условий, при которых эксплуатация транспортных средств запрещена

1. Управление транспортным средством при наличии неисправностей или условий, при которых в соответствии с Основными положениями по допуску транспортных средств к эксплуатации и обязанностями должностных лиц по обеспечению безопасности дорожного движения эксплуатация транспортного средства запрещена, за исключением неисправностей и условий, указанных в частях 2–6 настоящей статьи, влечет предупреждение или наложение административного штрафа в размере ста рублей.

2. Управление транспортным средством с заведомо неисправными тормозной системой (за исключением стояночного тормоза), рулевым управлением или сцепным устройством (в составе поезда) влечет наложение административного штрафа в размере от трехсот до пятисот рублей.

3. Управление транспортным средством, на передней части которого установлены световые приборы с огнями красного цвета или световозвращающие приспособления красного цвета, а равно световые приборы, цвет огней и режим работы которых не соответствуют требованиям Основных положений по допуску транспортных средств к эксплуатации и обязанностей должностных лиц по обеспечению безопасности дорожного движения, влечет лишение права управления транспортными средствами на срок от шести месяцев до одного года с конфискацией указанных приборов и приспособлений.

3.1. Управление транспортным средством, на котором установлены стекла (в том числе покрытые прозрачными цветными пленками), светопропускание которых не соответствует требованиям технического регламента о безопасности колесных транспортных средств, влечет наложение административного штрафа в размере пятисот рублей.

4. Управление транспортным средством, на котором без соответствующего разрешения установлены устройства для подачи специальных световых или звуковых сигналов (за исключением охранной сигнализации), влечет лишение права управления транспортными средствами на срок от одного года до полутора лет с конфискацией указанных устройств.

5. Использование при движении транспортного средства устройств для подачи специальных световых или звуковых сигналов (за исключением охранной сигнализации), установленных без соответствующего разрешения, влечет лишение права управления транспортными средствами на срок от полутора до двух лет с конфискацией указанных устройств.

6. Управление транспортным средством, на наружные поверхности которого незаконно нанесены специальные цветографические схемы автомобилей оперативных служб, влечет лишение права управления транспортными средствами на срок от одного года до полутора лет.

В первом пункте комментируемой статьи речь идет об управлении ТС с неисправностями или несоблюдении условий эксплуатации, при которых пользование ТС не разрешается. Законодатель в этом пункте делает ссылку на Основные положения, которые содержат Перечень неисправностей и условий, при которых запрещается эксплуатация транспортных средств (далее – Перечень). В ч. 1 ст. 12.5 КоАП РФ входят неисправности двигателя, колес и шин, стеклоочистителей и стеклоомывателей, прочих элементов конструкции.

Обратим внимание на сравнительно новые изменения в п. 7.9 Перечня: «Отсутствую тремни безопасности и (или) подголовники сидений, если их установка предусмотрена конструкцией транспортного средства или Основными положениями по допуску транспортных средств к эксплуатации и обязанностями должностных лиц по обеспечению безопасности дорожного движения » (в ред. постановления Правительства РФ от 24.02.2010 № 87). Если на вашем автомобиле конструктивно предусмотрены ремни безопасности, а реально их нет, то вы уже попадаете в сферу ответственности ч. 1 ст. 12.5 КоАП РФ.

Следует отметить, что неисправности и условия запрещения эксплуатации ТС исчерпывающе изложены в Перечне, никакие другие неисправности и условия не должны быть основанием для вынесения административного наказания по п. 1 ст. 12.5 КоАП РФ. Будьте внимательны при составлении протокола. За это правонарушение предусмотрено либо предупреждение, либо штраф 100 рублей и более никаких санкций.

Часть 2 ст. 12.5 КоАП РФ касается неисправности тормозной системы, рулевого управления или сцепного устройства (в составе поезда). Причем сделано исключение для стояночного тормоза. За его неисправность по ч. 2 ст. 12.5 КоАП РФ вы не можете быть привлечены к ответственности. Штраф составляет от 300 до 500 рублей, а также предусмотрено задержание транспортного средства и снятие с него государственных регистрационных знаков в порядке ст. 27.13 КоАП РФ. Это вызвано тем, что неисправности рулевой и тормозной систем, а также сцепного устройства могут повлечь очень серьезные последствия. Причем неисправности, указанные в комментируемом пункте, должны быть заведомыми, то есть вы, садясь за руль, знали, что тормозная и рулевая системы неисправны, но тем не менее не отказались от поездки. А это уже предмет доказывания при рассмотрении дела об административном право нарушении.

Если вы сможете устранить причину задержания ТС (отремонтировать неисправные системы или сцепное устройство) на месте выявления административного правонарушения, то эвакуировать вашу машину на спецстоянку не должны согласно п. 147.1 Административного регламента.

Проверка состояния тормозной системы теоретически возможна, но маловероятна (оборудование слишком громоздко). Зато излишний люфт рулевого управления, который измеряется с помощью довольно компактного люфтомера, вполне может доставить немало проблем (в первую очередь задержание авто, снятие номеров и последующая эвакуация).

В абзацах 3–6 настоящей статьи речь идет об управлении ТС, на котором установлены незаконные спецсигналы, не соответствующие ГОСТу 8769-75 световые устройства, стекла с большой степенью затемненности, а также об использовании в процессе движения устройств для подачи специальных световых и звуковых сигналов. И здесь наказание гораздо серьезнее – лишение права управления ТС, снятие номеров и запрещение эксплуатации ТС.

Дела, предусмотренные ч. 3–6 ст. 12.5, отнесены к компетенции судов, так как речь идет о лишении водительских прав. Это не касается части 3.1, наказание по которой предусмотрено в виде штрафа.

ГОСТ 8769-75 предписывает, что фары ближнего и дальнего света должны излучать белый или селективно-желтый свет. Также допускается установка противотуманных фар с белым или селективно-желтым светом. Ни о каких фарах красного цвета и световозвращающих приспособлениях речь не идет. И каждый водитель обязан об этом знать. Наличие не предусмотренных конструкцией автомобиля ксеноновых фар (газоразрядных источников света) и установка их в корпуса фар с лампами накаливания и галогеновыми лампами также подпадают под действие ч. 3 ст. 12.5 КоАП РФ (разъяснения Департамента обеспечения безопасности дорожного движения МВД России об использовании ксеноновых фар от 20.02.2010).

Данные о том, что на ТС, которым вы управляете, разрешено использовать звуковые и световые спецсигналы, а также цветографические схемы автомобилей оперативных служб, должны содержаться в свидетельстве о регистрации ТС. Если разрешения нет, а вы использовали такие спецсигналы или даже просто управляли таким ТС, то готовьтесь к лишению прав с конфискацией данных устройств.

Что касается нарушения по ч. 3.1 настоящей статьи, то здесь можно пояснить следующее. Тонировку стекол не запретили совсем, просто ее степень должна соответствовать нормам ГОСТа 5727-88. Светопропускание должно в обязательном порядке проверяться прибором тауметром, который имеет сертификат и свидетельство о поверке. Согласно ГОСТу 27902 «Стекло безопасное для автомобилей, тракторов и сельскохозяйственных машин. Определение оптических свойств», проверка светопропускания стекла проводится при температуре 20 °C выше ноля с погрешностью 5 °C в ту или иную сторону, влажность должна составлять 60 ± 20 %. Погрешность прибора должна быть не более 2 %. Причем проверять параметры светопропускания имеют право сотрудники ГИБДД на стационарных и контрольных постах, контрольно-пропускных пунктах для транспортных средств. Обратите внимание: при таком правонарушении должен выписываться только штраф, задерживать ТС, запрещать его эксплуатацию и снимать номера сотрудник ГИБДД не имеет права.

С 1 января 2012 года статья 12.5 дополняется двумя новыми частями: ч. 4.1 «Управление транспортным средством, на котором незаконно установлен опознавательный фонарь легкового такси, влечет наложение административного штрафа на водителя в размере пяти тысяч рублей с конфискацией предмета административного правонарушения » и ч. 7 «Управление транспортным средством, на которое незаконно нанесена цветографическая схема легкового такси, влечет наложение административного штрафа на водителя в размере пяти тысяч рублей». Согласно новым частям статьи, водитель, который не является сотрудником таксомоторной компании или не осуществляет индивидуальную деятельность по перевозке на легковом такси, при наличии цветографической схемы и опознавательного фонаря легкового такси, будет подлежать административной ответственности. Привлекать к ответственности за данное правонарушение сотрудники ГИБДД будут в том случае, если вы управляете данным автомобилем без соответствующего специального разрешения на перевозку людей и багажа на легковом такси.

Статья 12.6. Нарушение правил применения ремней безопасности или мотошлемов Управление транспортным средством водителем, не пристегнутым ремнем безопасности, перевозка пассажиров, не пристегнутых ремнями безопасности, если конструкцией транспортного средства предусмотрены ремни безопасности, а равно управление мотоциклом либо перевозка на мотоцикле пассажиров без мотошлемов или в незастегнутых мотошлемах влечет наложение административного штрафа в размере пятисот рублей.

Теперь, когда установлен достаточно крупный штраф в размере 500 рублей и отменено предупреждение, большая часть водителей стала пристегиваться ремнями безопасности. И этого они требуют от своих пассажиров.

Согласно п. 2.1.2 ПДД «водитель механического транспортного средства обязан при движении на транспортном средстве, оборудованном ремнями безопасности, быть пристегнутым и не перевозить пассажиров, не пристегнутых ремнями. При управлении мотоциклом быть в застегнутом мотошлеме и не перевозить пассажиров без застегнутого мотошлема». Правилами дорожного движения установлено, что пристегиваться ремнями безопасности должны все без исключения, не только водитель, но и пассажиры, находящиеся в транспортном средстве.

При управлении мотоциклом водитель должен быть сам в застегнутом мотошлеме и не должен перевозить пассажиров без застегнутого мотошлема.

Детей до 12 лет необходимо перевозить с использованием детских удерживающих устройств, соответствующих весу и росту ребенка (автокресел), либо с помощью иных средств, позволяющих пристегнуть ребенка ремнями безопасности.

Следует напомнить, что ремень безопасности и детское кресло созданы для того, чтобы обеспечить безопасность во время движения, позволить избежать более тяжких последствий, если вдруг произойдет ДТП.

Нормы данной статьи предусматривают ответственность только для водителя автомобиля. В случае если ремнем безопасности не пристегнут пассажир, то, кроме ответственности водителя, по ст. 12.29 КоАП РФ будет подвергнут административному взысканию и пассажир.

За безопасность пассажиров своего ТС отвечает водитель в рамках ст. 1079 ГК РФ, даже если он не был признан виновным в аварии. Это подтверждено и судебной практикой (решение Верховного Суда РФ от 26.08.1998 по жалобе о признании незаконным обязательного пристегивания ремнями безопасности).

В случае когда вы остановились и сотрудник ГИБДД утверждает, что вы совершили административное правонарушение и не были пристегнуты ремнем безопасности, вам достаточно ему заявить, что ремнем безопасности водитель обязан быть пристегнут лишь во время движения, а в данный момент автомобиль стоит и вы отстегнули ремень безопасности лишь с целью достать документы и предъявить их сотруднику ГИБДД.

Знайте, что в остановившейся машине и водитель, и пассажир не обязаны быть пристегнуты.

Если в машине есть пассажиры, они будут вашими свидетелями, не забудьте вписать их в протокол об административном правонарушении. Сотрудники ГИБДД иногда составляют протокол об административном нарушении за непристегнутый ремень безопасности, не имея никаких доказательств. Но если вы уверены в своей правоте, обжалуйте протокол, привлеките свидетелей. Помните, что и сам протокол может быть составлен с нарушением требований.

Статья 12.7. Управление транспортным средством водителем, не имеющим права управления транспортным средством

1. Управление транспортным средством водителем, не имеющим права управления транспортным средством (за исключением учебной езды), влечет наложение административного штрафа в размере двух тысяч пятисот рублей.

2. Управление транспортным средством водителем, лишенным права управления транспортным средством, влечет административный арест на срок до пятнадцати суток или наложение административного штрафа на лиц, в отношении которых в соответствии с настоящим Кодексом не может применяться административный арест, в размере пяти тысяч рублей.

3. Передача управления транспортным средством лицу, заведомо не имеющему права управления транспортным средством (за исключением учебной езды) или лишенному такого права, влечет наложение административного штрафа в размере двух тысяч пятисот рублей.

Управление ТС может осуществлять любой гражданин, имеющий соответствующее водительское удостоверение или временное разрешение на управление. Вышеупомянутая статья Кодекса относится к тем водителям, которые управляют ТС, хотя не имеют прав или лишены их, а также за передачу права управления таким лицам. В этом случае при рассмотрении дела об административном правонарушении подлежит обязательному доказыванию тот факт, что, передавая свой автомобиль в управление человеку, не имеющему прав или лишенному их, владелец автомобиля знал об этом и тем не менее передал, то есть присутствует вина в форме прямого умысла.

Должен быть зафиксирован факт передачи управления. Только тогда на владельца авто может быть возложена ответственность по ч. 3 ст. 12.7 КоАП РФ. Административной ответственности по этой статье подлежат лица, чьи разрешенные категории в водительском удостоверении не соответствуют категории транспортного средства, а также те, кто вовремя не продлил действие своего водительского удостоверения.

За нарушение ч. 1 и 2 ст. 12.7 КоАП РФ сотрудник ГИБДД имеет право задержать ваше ТС в порядке, предусмотренном ч. 1 ст. 27.13 КоАП РФ, но номерные знаки не подлежат снятию. Основаниями для проверки документов, необходимых для участия в дорожном движении, за исключением документов на перевозимый груз, являются: выявление нарушений ПДД, ориентировки, указания в соответствии с целями проведения специальных мероприятий, осуществление контрольных мероприятий на посту ГИБДД (п. 82 Административного регламента). При проверке документов вы не обязаны выходить из машины, а должны просто передать для ознакомления документы сотруднику ГИБДД. А сотрудник ГИБДД имеет право проверить ваши документы на подлинность с помощью технических средств или обратиться к базе данных, которая может быть доступна на посту ГИБДД, сделать запрос в дежурную часть по имеющимся каналам связи.

Административное правонарушение по ч. 2 ст. 12.7 КоАП РФ рассматривается судебными органами.

Административный арест обязательно назначается судьей, никто не может вас сразу же арестовать, причем при его назначении учитываются смягчающие и отягчающие административную ответственность обстоятельства. Смягчающие обстоятельства установлены ст. 4.2 КоАП РФ – это добровольное сообщение об административном правонарушении, раскаяние в совершенном правонарушении и пр. Перечень смягчающих обстоятельств не является закрытым, судья, рассматривающий дело, может признать смягчающими и иные обстоятельства. Перечень отягчающих обстоятельств содержится в ст. 4.3 КоАП РФ. Это совершение определенного правонарушения в состоянии опьянения, его повторное совершение в течение года, совершение правонарушения в условиях стихийного бедствия или иной чрезвычайной ситуации и др. Причем перечень отягчающих обстоятельств не может быть расширен, а судье дано право не признавать то или иное обстоятельство отягчающим в зависимости от характера административного правонарушения.

Статья 12.8. Управление транспортным средством водителем, находящимся в состоянии опьянения, передача управления транспортным средством лицу, находящемуся в состоянии опьянения

1. Управление транспортным средством водителем, находящимся в состоянии опьянения, влечет лишение права управления транспортными средствами на срок от полутора до двух лет.

2. Передача управления транспортным средством лицу, находящемуся в состоянии опьянения, влечет лишение права управления транспортными средствами на срок от полутора до двух лет.

3. Управление транспортным средством водителем, находящимся в состоянии опьянения и не имеющим права управления транспортными средствами либо лишенным права управления транспортными средствами, влечет административный арест на срок до пятнадцати суток или наложение административного штрафа на лиц, в отношении которых в соответствии с настоящим Кодексом не может применяться административный арест, в размере пяти тысяч рублей.

4. Повторное совершение административного правонарушения, предусмотренного частью 1 или 2 настоящей статьи, влечет лишение права управления транспортными средствами на срок три года.

Останавливая ваш автомобиль, сотрудник ГИБДД может заподозрить, что вы находитесь в состоянии алкогольного опьянения. При наличии таких подозрений он должен сообщить вам об этом и имеет полное право предложить выйти из машины. При этом для сотрудника ГИБДД достаточным основанием полагать, что вы находитесь в состоянии алкогольного опьянения, является наличие одного или нескольких признаков: запах алкоголя изо рта, неустойчивость позы, нарушение речи, резкое изменение окраски кожных покровов лица, поведение, не соответствующее обстановке. Хотя стоит отметить, что приведенные основания достаточно субъективны и могут быть вызваны иными причинами, нежели алкогольное опьянение. Попробуйте изложить свои доводы. Быть может, вы просто не выспались, принимаете определенные лекарства, которые могут дать такой эффект. Если все-таки сотрудник ГИБДД предлагает пройти освидетельствование, то лучше согласиться, но обязательно нужно следить за тем, чтобы при проведении освидетельствования были соблюдены ваши права.

При подобных подозрениях сотрудник ГИБДД имеет право отстранить вас от управления ТС, но если результаты освидетельствования будут отрицательными, вас обязаны будут доставить к месту нахождения вашего автомобиля.

Естественно, определить, находится ли человек в состоянии алкогольного опьянения, невозможно без проведения освидетельствования. В настоящее время действует постановление Правительства РФ от 26.06.2008 № 475 (далее – Постановление № 475), которым определены Правила освидетельствования лица, которое управляет ТС, на состояние алкогольного опьянения и оформления его результатов, направления указанного лица на медицинское освидетельствование на состояние опьянения, медицинского освидетельствования этого лица на состояние опьянения и оформления его результатов (далее – Правила освидетельствования). Также при проведении медицинского освидетельствования возможно и определение наличия наркотических и психотропных веществ в организме.

Подробнее порядок проведения освидетельствования на состояние алкогольного опьянения будет рассмотрен в комментарии к ст. 27.12 КоАП РФ.

Все административные правонарушения по данной статье рассматриваются только в судах. Для привлечения вас к ответственности по этой статье в суд должны быть представлены неопровержимые, не вызывающие сомнений доказательства того, что вы находились в состоянии опьянения. Это значит, что в деле должны присутствовать правильно составленные документы о том, что вы находились в состоянии опьянения (акты освидетельствования, протоколы) и управляли в этот момент ТС, а не просто сидели в припаркованной машине.

В случае привлечения вас к ответственности по ч. 2 ст. 12.8 КоАП РФ в обязательном порядке должен быть доказан факт, что вы передали управление автомобилем тому, кто находился в состоянии алкогольного опьянения. Если вчера вы выписали доверенность, а сегодня этот человек был остановлен за управление ТС в состоянии алкогольного опьянения и вас рядом не было, то вас не имеют права привлечь к ответственности по данной части. Но если вы сидели рядом на пассажирском сиденье, то факт передачи управления налицо.

Причем если водитель, находящийся в состоянии алкогольного опьянения, еще и лишен права управления ТС либо вовсе не имеет прав, то наказание за такое нарушение назначается в виде административного ареста. Если вы совершили правонарушения, предусмотренные п. 1 и 2 настоящей статьи, повторно, то вас могут лишить права управления ТС на три года. Здесь следует уточнить, что лицо считается подвергнутым административному наказанию в течение одного года со дня окончания исполнения постановления о назначении административного наказания.

Статья 12.9. Превышение установленной скорости движения

1. Превышение установленной скорости движения транспортного средства на величину не менее 10, но не более 20 километров в час влечет предупреждение или наложение административного штрафа в размере ста рублей.

2. Превышение установленной скорости движения транспортного средства на величину более 20, но не более 40 километров в час влечет наложение административного штрафа в размере трехсот рублей.

3. Превышение установленной скорости движения транспортного средства на величину более 40, но не более 60 километров в час влечет наложение административного штрафа в размере от одной тысячи до одной тысячи пятисот рублей.

4. Превышение установленной скорости движения транспортного средства на величину более 60 километров в час влечет наложение административного штрафа в размере от двух тысяч до двух тысяч пятисот рублей или лишение права управления транспортными средствами на срок от четырех до шести месяцев.

Данная статья предусматривает административное наказание за превышение установленной скорости движения. Административное наказание зависит от того, насколько вы превысили скорость. Правонарушения по ч. 1–3 ст. 12.9 КоАП РФ рассматривает сотрудник ГИБДД. А по ч. 4 той же статьи, в случае административного правонарушения в виде лишения права управления транспортным средством – только судами.

Ограничения скорости установлены п. 10 ПДД. В населенных пунктах разрешается движение ТС со скоростью не более 60 км/ч, а в жилых зонах и дворах – не более 20 км/ч. Вне населенных пунктов легковым автомобилям, а также грузовым с разрешенной максимальной массой не более 3,5 т на автомагистралях разрешено двигаться со скоростью не более 110 км/ч, на остальных дорогах – не более 90 км/ч, легковым автомобилям с прицепом, грузовым с разрешенной максимальной массой более 3,5 т на автомагистралях – не более 90 км/ч, на остальных дорогах – не более 70 км/ч. Если ваш автомобиль буксирует другое механическое транспортное средство, то его скорость не должна превышать 50 км/ч.

В настоящее время подразделения ДПС обеспечены различными типами измерителей скорости: автоматическими радарами, приборами с видеофиксатором, ручными радарами. Все эти измерительные приборы должны быть сертифицированы в качестве средства измерения, иметь действующее свидетельство о поверке, выдаваемое органами Федерального агентства по техническому регулированию и метрологии (хранится в подразделении), и применяться в соответствии с инструкциями и методическими указаниями о порядке применения этих средств (п. 46 Административного регламента).

В протоколе об административном правонарушении обязательно должны быть указаны название и марка измерительного прибора, его серийный номер и дата поверки. Если этих данных нет или они представлены в неполном объеме, то протокол может быть вами обжалован.

При применении обычного радара сотрудник ГИБДД еще должен доказать, что на дисплее скорость именно вашего автомобиля, а не шедшего впереди, который уже скрылся из поля видимости. Пишите в разделе объяснений протокола, что не согласны с привлечением к административной ответственности, так как скорость не превышали. Сложнее будет с радаром, который фиксирует и номер автомобиля, и его внешний вид. Стоит обратить внимание на то, читается ли номер. Если нет, попросите сделать об этом запись в протоколе или напишите сами в разделе объяснений. Затем вы можете обжаловать постановление о привлечении к административной ответственности на основании того, что достоверно не доказано превышение скорости именно вашим автомобилем.

Если видеофиксация производится с помощью компьютера, то не забудьте, что программное обеспечение и операционная система должны быть лицензированы. Попросите занести в протокол данные о лицензиях или об их отсутствии. Если сотрудник ГИБДД отказывается сделать это, то напишите сами.

Не забывайте и о том, что любой измерительный прибор должен использоваться в соответствии с инструкцией. Готовясь к обжалованию постановления, обязательно найдите данную инструкцию в Интернете, убедитесь, что сотрудник ГИБДД использовал прибор правильно: при надлежащей температуре воздуха, правильной установке, соблюдении дальности действия и т. п.

Также водитель не обязан нести ответственность за превышение скорости движения в случае неправильной установки дорожных знаков. Согласно п. 5.4.22 ГОСТа Р 52289-2004 «Технические средства организации дорожного движения. Правила применения дорожных знаков, разметки, светофоров, дорожных ограждений и направляющих устройств» знак 3.24 «Ограничение максимальной скорости» применяют для запрещения движения всех ТС со скоростью выше указанной на знаке при необходимости введения на участке дороги иной максимальной скорости, чем на предшествующем участке.

При ограничении скорости движения на опасных участках дороги (крутые повороты, необеспеченная видимость встречного автомобиля, сужение дороги и т. п.) зона действия знака должна соответствовать протяженности опасного участка.

Если на данном участке устанавливают максимальную скорость, отличающуюся от максимальной скорости движения на предшествующем участке на 20 км/ч и более, применяют ступенчатое ограничение скорости с шагом не более 20 км/ч путем последовательной установки знаков 3.24 на расстоянии 100–150 м друг от друга.

Ступенчатое ограничение скорости допускается не применять перед населенным пунктом, обозначенным знаком 5.23.1 или 5.23.2 (начало населенного пункта), в случае если расстояние видимости знака более 150 м.

Знак 3.24 с табличкой 8.2.1 (зона действия) перед искусственной неровностью устанавливают вкупе со знаком 5.20 (искусственная неровность) на одной опоре. Значение скорости, указываемое на знаке, должно соответствовать конструкции неровности.

Для знака 3.24 «Ограничение максимальной скорости» применяется следующее положение вышеуказанного ГОСТа: «Если дорога имеет две или более полосы для движения в одном направлении, то дублирующие знаки устанавливают на разделительной полосе.

На дорогах без разделительной полосы дублирующие знаки устанавливают:

 слева от проезжей части в случаях, когда встречное движение осуществляется по одной или двум полосам;

 над проезжей частью в случаях, когда встречное движение осуществляется по трем или более полосам».

Стоит также сказать, что на вас распространяется презумпция невиновности, поэтому доказать превышение вами скорости должен сотрудник ГИБДД, а вы имеете право обжаловать как его действия, так и вынесенное им постановление.

В случае фото– или видеофиксации совершенного вами административного правонарушения (превышение скорости) видеокамерами, работающими в автоматическом режиме, которые установлены над проезжей частью, протокол об административном правонарушении не составляется. Согласно ч. 3 ст. 28.6 КоАП РФ, в отношении вас выносится сразу постановление об административном правонарушении с указанием размера штрафа. Доставляется постановление на ваш адрес, указанный при регистрации транспортного средства, в течение трех дней с момента вынесения. Если вы не согласны с данным постановлением, включая размер штрафа, который там указан, то вы вправе его обжаловать в течение 10 дней со дня получения.

Статья 12.10. Нарушение правил движения через железнодорожные пути

1. Пересечение железнодорожного пути вне железнодорожного переезда, выезд на железнодорожный переезд при закрытом или закрывающемся шлагбауме либо при запрещающем сигнале светофора или дежурного по переезду, а равно остановка или стоянка на железнодорожном переезде влечет наложение административного штрафа в размере пятисот рублей или лишение права управления транспортными средствами на срок от трех до шести месяцев.

2. Нарушение правил проезда через железнодорожные переезды, за исключением случаев, предусмотренных частью 1 настоящей статьи, влечет наложение административного штрафа в размере ста рублей.

3. Повторное совершение административного правонарушения, предусмотренного частью 1 настоящей статьи, влечет лишение права управления транспортными средствами на срок один год.

Данная статья регламентирует ответственность за нарушение правил движения через железнодорожные пути. Такие нарушения чрезвычайно опасны для жизни, поэтому их лучше совсем не допускать.

Вообще, правила движения через железнодорожные пути регламентированы п. 15 ПДД. Случаи привлечения к ответственности по ч. 1 перечислены исчерпывающим образом, но для привлечения водителя к административной ответственности вина должна быть неопровержимо доказана.

К ч. 2 относятся правонарушения по несоблюдению остальных правил проезда через переезд:

• объезд с выездом на полосу встречного движения стоящих перед переездом ТС;

• самовольное открытие шлагбаума;

• провоз через переезд в нетранспортабельном положении сельскохозяйственных, дорожных, строительных и других машин и механизмов;

• без разрешения начальника дистанции пути железной дороги движение тихоходных машин, скорость которых менее 8 км/ч, а также тракторных саней-волокуш.

Правонарушение по ч. 1 и 3 ст. 12.10 КоАП РФ рассматривается в суде, в случае назначения наказания в виде лишения права управления транспортным средством. Следует сказать, что повторное правонарушение будет иметь место в том случае, если вы еще считаетесь подвергнутым административному наказанию, то есть еще не истек год со дня окончания исполнения постановления о назначении административного наказания. Дело об административном правонарушении, предусмотренном ч. 1 ст. 12.10 КоАП РФ, также может быть передано на рассмотрение в суд. При квалификации правонарушения сотрудник ГИБДД обязан указать в протоколе, какое именно правонарушение совершено – пересечение железнодорожного пути вне железнодорожного переезда, выезд на железнодорожный переезд при закрытом шлагбауме, выезд на железнодорожный переезд при запрещающем сигнале светофора, остановка на железнодорожном переезде.

Ст. 12.12. Проезд на запрещающий сигнал светофора или запрещающий жест регулировщика Проезд на запрещающий сигнал светофора или на запрещающий жест регулировщика, за исключением случаев, предусмотренных частью 1 статьи 12.10 настоящего Кодекса, влечет наложение административного штрафа в размере семисот рублей.

Рассмотрим подробнее нормы данной статьи.

Согласно пп. 6.2–6.3 ПДД запрещается движение на красный сигнал светофора, в том числе и мигающий; при включении сочетания красного и желтого сигналов. Желтый сигнал светофора также запрещает движение, кроме специально оговоренного в п. 6.14 случая, когда водители уже не могут остановиться, не прибегая к экстренному торможению. Запрещающим жестом регулировщика является поднятие руки вверх.

Если вы продолжаете движение, несмотря на включение запрещающего сигнала светофора или запрещающий жест регулировщика, соответственно, вы совершаете административное правонарушение, предусмотренное ст. 12.12 КоАП РФ. Штраф за него фиксированный и не может быть уменьшен или увеличен.

Но если вы ничего не нарушали и считаете, что остановивший вас сотрудник ГИБДД не прав, то помогут несколько советов. После того как вас остановил сотрудник ГИБДД, он должен четко и разборчиво представиться, объяснить причину остановки и назвать пункт правил и ту статью Кодекса, которую вы нарушили. Не паникуйте и не спорьте. Будьте сдержанны и вежливы, но твердо отстаивайте свое мнение. Очень хорошо, если есть свидетели, например пассажиры вашего автомобиля, и они согласны дать показания о том, что вы не нарушали ПДД. У свидетелей сотрудники ГИБДД обязаны взять объяснения (обычно записывают на отдельном листе) и зафиксировать их данные в протоколе об административном правонарушении. Конечно, большим плюсом станет наличие видеокамеры на месте якобы совершенного правонарушения. В этом случае вы однозначно должны затребовать запись, фиксирующую ситуацию на дороге в тот момент времени, когда ехали. Стоит упомянуть про то, что вы сами можете вести аудио– или видеозапись происходящего при составлении протокола.

С 1 января 2012 года данная статья меняется практически полностью и дополняется следующим содержанием.

1. Проезд на запрещающий сигнал светофора или на запрещающий жест регулировщика, за исключением случаев, предусмотренных частью 1 статьи 12.10 настоящего Кодекса и частью 2 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи рублей.

2. Невыполнение требования Правил дорожного движения об остановке перед стоп-линией, обозначенной дорожными знаками или разметкой проезжей части дороги, при запрещающем сигнале светофора или запрещающем жесте регулировщика влечет наложение административного штрафа в размере восьмисот рублей.

Это разграничивает административные правонарушения, которые регулируются данной статьей. В частности, несоблюдение п. 6.13 ПДД, который предусматривает обязательную остановку транспортного средства перед стоп-линией, обозначенной дорожными знаками (6.16) и разметкой. Штраф за совершение данного правонарушения составляет 800 рублей. Остальные нарушения п. 6.13 ПДД (остановка в случае отсутствия стоп-линии: на перекрестке – перед пересекаемой проезжей частью, перед железнодорожным переездом, перед светофором или регулировщиком) регламентируются уже ч. 1 ст. 12.12 КоАП РФ и предусматривают наказание в виде штрафа в размере 1000 рублей.

Это единственное разграничение, которое проводится нормами Кодекса. К примеру, если вы не остановились перед пересекаемой проезжей частью, хотя загорелся красный сигнал светофора, сотрудник ГИБДД привлекает вас к ответственности по ч. 1 ст. 12.12 КоАП РФ, ну а если перед перекрестком была стоп-линия и/или дорожный знак 6.16, то вас обязаны привлечь лишь по ч. 2 ст. 12.12 КоАП РФ.

Статья 12.13. Нарушение правил проезда перекрестков

1. Выезд на перекресток или пересечение проезжей части дороги в случае образовавшегося затора, который вынудил водителя остановиться, создав препятствие для движения транспортных средств в поперечном направлении, влечет предупреждение или наложение административного штрафа в размере ста рублей.

2. Невыполнение требования ПДД уступить дорогу транспортному средству, пользующемуся преимущественным правом проезда перекрестков, влечет наложение административного штрафа в размере от ста до двухсот рублей.

Эта статья регламентирует ответственность за проезд перекрестков с нарушением ПДД. В ч. 1 правонарушением признан выезд на перекресток в случае затора, который вынудил водителя остановиться, создав препятствие для движения ТС в поперечном направлении. То есть признаком правонарушения является именно создание препятствий для движения ТС в поперечном направлении. Часть 2 ст. 12.13 КоАП РФ предусматривает невыполнение требования уступить дорогу ТС, которое пользуется преимущественным правом проезда (например, трамвай). Содержание требования уступить дорогу раскрыто в ПДД и означает, что «участник дорожного движения не должен начинать, возобновлять или продолжать движение, осуществлять какой-либо маневр, если это может вынудить других участников движения, имеющих по отношению к нему преимущество, изменить направление движения или скорость». Согласно ПДД «перекресток – это место пересечения, примыкания или разветвления дорог на одном уровне, ограниченное воображаемыми линиями, соединяющими соответственно противоположные, наиболее удаленные от центра перекрестка начала закруглений проезжих частей».

Перекрестками не считаются выезды с прилегающих территорий. Определение прилегающей территории также дано в ПДД. Это территория, непосредственно прилегающая к дороге и не предназначенная для сквозного движения транспортных средств. Это могут быть территории предприятий, жилые массивы, дворы, заправочные станции. Если вас остановил сотрудник ГИБДД за то, что вы не пропустили выезжающий из двора автомобиль, мотивируя это тем, что данный автомобиль явился для вас помехой справа и при отсутствии знаков приоритета вы должны были его пропустить, можно с полной уверенностью заявить, что если водитель выехал из жилой зоны, обозначенной знаками 5.38 и 5.39, то он должен уступить дорогу другим участникам дорожного движения согласно п. 17.3. ПДД. Поэтому, даже если на вас составили протокол, в разделе объяснений или на отдельном листе изложите свою позицию – вы в этом случае абсолютно правы и можете в дальнейшем обжаловать протокол и действия сотрудника ГИБДД.

Перекрестки могут быть регулируемыми и нерегулируемыми. На регулируемом перекрестке необходимо четко руководствоваться сигналами светофора или регулировщика.

Запомните: если вы выехали на перекресток при разрешающем сигнале светофора или регулировщика, то имеете право закончить движение через перекресток независимо от сигнала светофора на выходе с перекрестка.

Но если на перекрестке несколько светофоров и имеются стоп-линии, вы должны руководствоваться сигналами каждого светофора. В ситуации, когда вам загорелся зеленый, но пешеходы, автомобили или трамваи не закончили свое движение, вы обязаны дать им возможность завершить движение и только после этого ехать.

Если светофор не работает, а регулировщика на перекрестке нет, то он считается нерегулируемым и водители должны руководствоваться знаками приоритета. Нерегулируемые перекрестки делятся на перекрестки равнозначных и неравнозначных дорог. При проезде перекрестков неравнозначных дорог приоритет имеют ТС, находящиеся на главной дороге. Главной считается дорога либо обозначенная соответствующими знаками, либо дорога с твердым покрытием по отношению к грунтовой. Если главная дорога на перекрестке меняет направление, то водители должны руководствоваться правилами проезда перекрестка равнозначных дорог. При проезде перекрестка равнозначных дорог вы должны уступить дорогу автомобилям, приближающимся справа. Но трамвай на таких перекрестках имеет преимущество перед безрельсовыми ТС независимо от направления его движения. С целью снижения аварийности предусмотрена норма правил о том, что когда вы не можете определить наличие покрытия на дороге, а знаков приоритета нет, то должны полагать, что находитесь на второстепенной дороге.

С 1 января 2012 года увеличиваются штрафы за совершение административных правонарушений, предусмотренных ч. 1 и 2 ст. 12.13 КоАП РФ. В следующем году они составят 1000 рублей за каждое правонарушение. Это изменение в законодательстве вызвано действиями самих водителей, нарушающих Правила дорожного движения и создающих тем самым аварийные ситуации и многочисленные пробки на дорогах. Увеличение штрафов призвано улучшить ситуацию на дорогах: уменьшить количество пробок и дорожно-транспортных происшествий.

Статья 12.14. Нарушение правил маневрирования

1. Невыполнение требования ПДД подать сигнал перед началом движения, перестроением, поворотом, разворотом или остановкой влечет предупреждение или наложение административного штрафа в размере ста рублей.

1.1. Невыполнение требования ПДД, за исключением установленных случаев, перед поворотом направо, налево или разворотом заблаговременно занять соответствующее крайнее положение на проезжей части, предназначенной для движения в данном направлении, влечет предупреждение или наложение административного штрафа в размере ста рублей.

2. Разворот или движение задним ходом в местах, где такие маневры запрещены, за исключением случаев, предусмотренных частью 3 статьи 12.11 настоящего Кодекса, влечет наложение административного штрафа в размере ста рублей.

3. Невыполнение требования ПДД уступить дорогу транспортному средству, пользующемуся преимущественным правом движения, за исключением случаев, предусмотренных частью 2 статьи 12.13 и статьей 12.17 настоящего Кодекса, влечет предупреждение или наложение административного штрафа в размере ста рублей.

Часть 1 ст. 12.14 КоАП РФ посвящена такому распространенному в настоящее время нарушению, как невыполнение требований ПДД подать сигнал перед началом движения, перестроением, поворотом, разворотом или остановкой. Сигналы подаются либо указателями поворотов, либо рукой, если указатели неисправны или отсутствуют. Сигнал должен подаваться заблаговременно и прекращаться немедленно после завершения маневра.

Если вас останавливает сотрудник ГИБДД и вменяет административное правонарушение по ч. 1 ст. 12.14 КоАП РФ, а вы не согласны с этим, так как вовремя включали и выключали поворотники, действуйте следующим образом. При составлении протокола в отношении вас напишите свою версию происшедшего в разделе объяснений, потребуйте внести данные о свидетелях. Сотруднику ГИБДД будет чрезвычайно сложно доказать, что вы не включили поворотник перед маневром. На участке дороги, где вы ехали, может быть установлена видеокамера. Ее запись также может стать доказательством вашей правоты.

Часть 2 ст. 12.14 КоАП РФ действует в случае нарушения пп. 8.11-8.12 ПДД. Это подтверждают и официальные разъяснения ГИБДД. Пунктом 8.11 Правил дорожного движения запрещен разворот на пешеходном переходе, в тоннелях, на мостах, путепроводах, эстакадах и под ними, на железнодорожных переездах, в местах с видимостью дороги хотя бы в одном направлении менее 100 м. В этих же местах также запрещено движение задним ходом. При квалификации данного правонарушения основным является то, где именно произошел разворот либо движение задним ходом. Перечень таких мест в п. 8.11 ПДД исчерпывающий и не подлежит расширению.

Часть 3 ст. 12.14 КоАП РФ предусматривает ответственность за невыполнение требования ПДД уступить дорогу транспортному средству, пользующемуся преимущественным правом движения. Причем в сферу действия данной части статьи отнесены не все случаи. Законодатель вынес некоторые составы административных правонарушений за ее рамки. Это касается ч. 2 ст. 12.13 КоАП РФ (невыполнение требования ПДД уступить дорогу транспортному средству, пользующемуся преимущественным правом проезда перекрестков) и ст. 12.17 КоАП РФ (непредоставление преимущества маршрутному ТС и ТС со включенными спецсигналами). Согласно пп. 8.3–8.10 ПДД при выезде на дорогу с прилегающей территории водитель должен уступить дорогу ТС и пешеходам, движущимся по ней, а при съезде с дороги – пешеходам и велосипедистам, путь движения которых он пересекает. При перестроении водитель должен уступить дорогу ТС, движущимся попутно без изменения направления движения. При одновременном перестроении ТС, движущихся попутно, водитель должен уступить дорогу ТС, находящемуся справа. При повороте налево или развороте вне перекрестка водитель безрельсового ТС обязан уступить дорогу встречным ТС и трамваю попутного направления.

В соответствии с пп. 13.4, 13.5, 13.12 ПДД при повороте налево или развороте по зеленому сигналу светофора водитель безрельсового ТС обязан уступить дорогу ТС, движущимся со встречного направления прямо и направо. Таким же правилом должны руководствоваться водители трамваев.

При движении в направлении стрелки, включенной в дополнительной секции одновременно с желтым или красным сигналом светофора, водитель обязан уступить дорогу ТС, движущимся с других направлений.

При повороте налево или развороте водитель безрельсового ТС обязан уступить дорогу ТС, движущимся по равнозначной дороге со встречного направления.

Не признавайте свою вину, поскольку потом очень сложно доказывать обратное. Четко и ясно изложите свою позицию в отношении вменяемого правонарушения, привлеките свидетелей. При составлении протокола часто допускаются ошибки, и они будут вам только на пользу – протокол могут отменить по процессуальным нарушениям.

Статья 12.15. Нарушение правил расположения транспортного средства на проезжей части дороги, встречного разъезда или обгона

1. Нарушение правил расположения транспортного средства на проезжей части дороги, встречного разъезда, а равно движение по обочинам или пересечение организованной транспортной или пешей колонны либо занятие места в ней влечет наложение административного штрафа в размере пяти сот рублей.

2. Движение по велосипедным или пешеходным дорожкам либо тротуарам в нарушение ПДД влечет наложение административного штрафа в размере двух тысяч рублей.

3. Выезд в нарушение ПДД на полосу, предназначенную для встречного движения, при объезде препятствия влечет наложение административного штрафа в размере от одной тысячи до одной тысячи пятисот рублей.

4. Выезд в нарушение ПДД на полосу, предназначенную для встречного движения, либо на трамвайные пути встречного направления, за исключением случаев, предусмотренных частью 3 настоящей статьи, влечет лишение права управления транспортными средствами на срок от четырех до шести месяцев, а в случае фиксации административного правонарушения работающими в автоматическом режиме специальными техническими средствами, имеющими функции фото– и киносъемки, видеозаписи, или средствами фото-и киносъемки, видеозаписи, – наложение административного штрафа в размере пяти тысяч рублей.

Полосой движения является любая из продольных полос проезжей части, обозначенная или не обозначенная разметкой и имеющая ширину, достаточную для движения автомобилей в один ряд. Обычно транспортные потоки противоположных направлений разделяются горизонтальной разметкой. Если отсутствует дорожная разметка, стороной, предназначенной для встречного движения, считается половина ширины проезжей части, расположенная слева, не считая местных уширений проезжей части (переходно-скоростные полосы, дополнительные полосы на подъем, заездные карманы мест остановок маршрутных ТС). Такое деление проезжей части действительно при любой ее ширине. При отсутствии разметки и знаков, информирующих о количестве полос, количество полос движения для безрельсовых транспортных средств определяют сами водители с учетом ширины проезжей части, габаритов ТС и необходимых интервалов между ними.

В части 1 статьи ключевым моментом является то, что при указанных нарушениях правил не происходит выезда ТС на сторону дороги, предназначенную для встречного движения. Таким нарушением может быть обгон справа, движение тихоходного ТС по левой полосе, несоблюдение требований уступить дорогу при встречном разъезде водителем, на чьей стороне находится препятствие, и некоторые другие. Отследите тот момент, нарушение каких именно пунктов ПДД вам приписывают.

По ч. 3 ст. 12.15 выписывается штраф за то, что вы выехали на встречную полосу для объезда препятствия. Определение препятствия зафиксировано в ПДД: «Препятствие – неподвижный объект на полосе движения (неисправное или поврежденное транспортное средство, дефект проезжей части, посторонние предметы и т. п.), не позволяющий продолжить движение по этой полосе». Если сотрудник ГИБДД, даже при наличии на дороге препятствия, хочет составить на вас протокол по ч. 4 ст. 12.15 КоАП РФ, не соглашайтесь с вменяемым вам в вину нарушением. Сфотографируйте препятствие с разных ракурсов, заручитесь поддержкой свидетелей.

Часть 4 ст. 12.15 очень любят применять сотрудники ГИБДД, но порой из-за ошибок в составлении документов и недоказанности совершения вами нарушения в суде происходит переквалификация либо вообще прекращение в отношении вас дела об административном правонарушении.

Ч. 4 ст. 12.15 КоАП РФ гласит: « Выезд в нарушение ПДД на сторону дороги, предназначенную для встречного движения. ..». Эта часть статьи ссылается на прямое нарушение ПДД. Поэтому только если в описании состава и события административного правонарушения указывается о выезде на встречную именно в нарушение ПДД, а также указывается и четко раскрывается пункт ПДД, соответствующий описанию и разъяснениям Постановления № 23, то привлечение можно считать правомерным. Исходя из Правил дорожного движения, можно сделать вывод, что пунктов, прямо запрещающих выезд на встречную полосу, всего пять.

1. Запрещается выезжать для обгона или объезда на полосу, предназначенную для встречного движения, на дорогах с двусторонним движением, имеющих четыре или более полос (на таких дорогах повороты налево или развороты могут выполняться на перекрестках и в других местах, где это не запрещено Правилами, знаками и (или) разметкой) (п. 9.2 ПДД РФ).

2. На дорогах с двусторонним движением, имеющих три полосы, обозначенные разметкой (за исключением разметки 1.9), из которых средняя используется для движения в обоих направлениях, запрещается съезжать на крайнюю левую полосу, предназначенную для встречного движения (п. 9.3 ПДД РФ).

3. Запрещается выезжать на трамвайные пути встречного направления (п. 9.6 ПДД РФ).

4. Обгон (значит выезд на встречную полосу) запрещен на регулируемых перекрестках, а также на нерегулируемых перекрестках при движении по дороге, не являющейся главной; на пешеходных переходах при наличии на них пешеходов; на железнодорожных переездах и ближе чем за 100 метров перед ними; на мостах, путепроводах, эстакадах и под ними, а также в тоннелях; в конце подъема, на опасных поворотах и на других участках с ограниченной видимостью (п. 11.4 ПДД РФ).

5. Запрещается объезжать с выездом на полосу встречного движения стоящие перед переездом транспортные средства (п. 15.3 ПДД РФ).

Стоит напомнить, что обгоном считается опережение ТС, при котором происходит выезд на полосу встречного движения. Все остальное – это опережение.

Если выезд на встречную полосу явился вынужденным маневром во избежание ДТП, когда вас попросту вытеснили из крайней левой полосы, то это будет как раз условием наступления состояния крайней необходимости, которое должно быть учтено в случае привлечения к ответственности, а то и вовсе освобождения от нее. Но чтобы доказать это, вам необходимо найти свидетелей происшедшего.

Если вас пытаются привлечь к административной ответственности по ч. 3 или 4 комментируемой статьи, хотя выезда на встречную полосу не было, обязательно предпримите следующие действия. В протоколе сделайте запись, что не согласны с вменяемым нарушением. Согласно п. 118 Административного регламента требуйте составления схемы места совершения нарушения ПДД, а если она не соответствует действительности, можете составить свою, а на схеме, составленной сотрудником ГИБДД, напишите: «Со схемой не согласен». Сотрудник ГИБДД обязан выдать вам копию составленной схемы. Если не выдаст, то напишите в протоколе: «Копию схемы не предоставили». Пусть вашу схему подпишут свидетели, если они есть. Свою схему составьте в двух экземплярах и потребуйте, чтобы один из них сотрудник ГИБДД приобщил к материалам дела. Вам также нужно вести аудио– или видеозапись общения с сотрудником ГИБДД, чтобы потом предъявить ее в суде. По возможности сделайте фотографии места нарушения, имеющейся разметки, дорожных знаков, препятствия, которое вынудило вас выехать на полосу встречного движения. Необходимо при фотографировании фиксировать время, чтобы впоследствии можно было определить, когда именно сделано фото.

Не отказывайтесь подписывать протокол. Ваша подпись не означает согласия с вменяемым правонарушением.

Административное дело по ч. 4 ст. 12.15 КоАП РФ рассматривается мировыми судьями. Перед тем как отправиться на заседание суда, внимательно изучите составленные в отношении вас документы. Чаще всего более легким путем отмены вынесенного постановления являются именно процессуальные нарушения, допущенные при составлении протокола, схемы нарушения и пр. В случае фиксации нарушения по ч. 4 ст. 12.15 КоАП РФ видеокамерами, работающими в автоматическом режиме, на вас будет наложен штраф в размере 5000 руб. Следует обратить внимание, что в случае фиксации нарушения камерой видеонаблюдения номера вашего автомобиля должны быть четко видны. Малейшие сомнения в трактовке цифр и букв номеров авто должны толковаться в пользу лица, которое привлекли к административной ответственности.

Статья 12.16. Несоблюдение требований, предписанных дорожными знаками или разметкой проезжей части дороги

1. Несоблюдение требований, предписанных дорожными знаками или разметкой проезжей части дороги, за исключением случаев, предусмотренных частями 2 и 3 настоящей статьи и другими статьями настоящей главы, влечет предупреждение или наложение административного штрафа в размере трехсот рублей.

2. Поворот налево или разворот в нарушение требований, предписанных дорожными знаками или разметкой проезжей части дороги, влечет наложение административного штрафа в размере от одной тысячи до одной тысячи пятисот рублей.

3. Движение во встречном направлении по дороге с односторонним движением влечет наложение административного штрафа в размере пяти тысяч рублей или лишение права управления транспортными средствами на срок от четырех до шести месяцев.

Часть 1 данной статьи КоАП РФ предполагает наступление административной ответственности за несоблюдение требований, предписанных дорожными знаками или разметкой проезжей части дороги, за исключением случаев, предусмотренных ч. 2 и 3 настоящей статьи или другими статьями настоящей главы. На это и обратим внимание.

Если вы совершили правонарушение, которое может быть квалифицировано как по ст. 12.15 КоАП РФ, так и по статье 12.16 КоАП РФ, то применяться будет ст. 12.15.

В постановлении Пленума ВС РФ от 24.11.2006 № 18 «О некоторых вопросах, возникающих у судов при применении особенной части Кодекса Российской Федерации об административных правонарушениях» (в ред. Постановления № 23) в п. 12 указывается, нарушение требований каких дорожных знаков и разметки подпадает под действие ст. 12.15 КоАП РФ: «Нарушение водителями требований дорожных знаков или разметки, которое повлекло выезд на сторону проезжей части дороги, предназначенную для встречного движения, также следует квалифицировать по части 3 или части 4 статьи 12.15 КоАП РФ, поскольку эти нормы являются специальными по отношению к статье 12.16 КоАП РФ. Такие ситуации могут возникнуть, например, при движении по дороге с одной полосой движения для каждого направления в результате нарушения требований дорожных знаков: 3.20 „Обгон запрещен” (этот знак запрещает обгон всех транспортных средств, кроме тихоходных транспортных средств, гужевых повозок, мопедов и двухколесных мотоциклов без коляски ), 3.22 „Обгон грузовым автомобилям запрещен”, 5.11 „Дорога с полосой для маршрутных транспортных средств”, а также дорожной разметки 1.1. Нарушение водителем требований дорожного знака 3.1 „Въезд запрещен”, повлекшее движение во встречном направлении по дороге, предназначенной для одностороннего движения, также необходимо квалифицировать как выезд в нарушение ПДД на сторону дороги, предназначенную для встречного движения ». Теперь в ПДД РФ четко установлено, что в случае противоречия между собой дорожных знаков и разметки приоритет имеют дорожные знаки (Приложение 1 ПДД РФ).

Данные разъяснения, конечно, спорные, но все-таки они внесли ясность и единообразие в судебную практику по административным делам данного рода.

Наказание по ч. 1 ст. 12.16 КоАП РФ определяется штрафом в размере 300 рублей и выносится сотрудником ГИБДД на месте совершения правонарушения. Если вы не согласны с вменяемым вам наказанием, то обратите внимание, соответствует ли разметка и дорожный знак ГОСТу, а также правильно ли они нанесены и установлены. Дорожный знак может быть не виден (скрываться за густой растительностью или опорой линий электропередач). По возможности сфотографируйте место нарушения, чтобы четко были видны знак и разметка, потребуйте составления схемы нарушения. Сфотографируйте знак либо разметку именно с того места, где вас остановили. Наличие свидетелей также может сыграть в вашу пользу, внесите их данные в протокол.

Часть 2 ст. 12.16 предусматривает наказание за поворот налево или разворот в нарушение требований дорожных знаков или разметки. Это касается не только крайних рядов, но и остальных полос движения. Если вас пытаются привлечь к административной ответственности по ч. 2 или 3 ст. 12.16, необходимо зафиксировать наличие дорожных знаков или разметки, записать имеющихся свидетелей, чтобы потом вызвать их на рассмотрение дела об административном правонарушении. Следует сказать, что движение задним ходом на дороге с односторонним движением не запрещается. Задним ходом можно ехать до пешеходного перехода или перекрестка. Вы вполне можете ехать задним ходом до въезда во двор, например. Напомню, что такой въезд не считается перекрестком.

Определенная несправедливость состоит в том, что нарушение по ч. 3 ст. 12.16 КоАП РФ может караться не только штрафом, но и лишением прав на срок от 4 до 6 месяцев. Дела по лишению прав рассматриваются в судебном порядке.

С 1 июля 2012 года статья претерпевает некоторые изменения. В ч. 1 «предусмотренных частями 2 и 3 настоящей статьи » заменяется на «предусмотренных частями 2 и 5 настоящей статьи ». Добавляются также две новые части.

4. Несоблюдение требований, предписанных дорожными знаками или разметкой проезжей части дороги, запрещающими остановку или стоянку транспортных средств, за исключением случая, предусмотренного частью 5 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи пятисот рублей.

5. Нарушение, предусмотренное частью 4 настоящей статьи, совершенное в городе федерального значения Москве или Санкт-Петербурге, влечет наложение административного штрафа в размере трех тысяч рублей.

Данные части вносятся в статью 12.16 КоАП РФ с целью научить водителей соблюдать Правила дорожного движения, в частности, руководствоваться дорожными знаками (3.27-3.30 и т. д.) и разметкой (1.4, 1.10 и т. д.), запрещающим остановку и/или стоянку транспортных средств. Так, например, за несоблюдение требований дорожного знака 3.27 «Остановка запрещена» водителю придется заплатить штраф в размере 1500 рублей. При этом сотрудником ГИБДД может быть принято решение об отстранении водителя от управления транспортным средством и направлении автомобиля на специализированную штрафную стоянку, согласно ч. 1 ст. 27.13 КоАП РФ.

Часть 5 предусматривает те же самые нормы, но регламентирует их лишь территориально, только в пределах городов федерального значения Москвы и Санкт-Петербурга. Так, за совершение того же административного правонарушения, но уже в пределах Москвы или Санкт-Петербурга, водителю придется заплатить штраф в размере уже 3000 рублей вместо 1500 рублей. Как только вы пересекаете черту города, на вас станут распространяться нормы ч. 4 данной статьи. Это, по мнению законодателей, научит водителей соблюдать правила остановки и стоянки транспортных средств, не создавать дополнительных помех движению других автомобилей, что, в свою очередь, позволит обеспечить беспрепятственное движение по дорогам городов федерального значения Москвы и Санкт-Петербурга и уменьшит количество пробок.

Статья 12.17. Непредоставление преимущества в движении маршрутному транспортному средству или транспортному средству с включенными специальными световыми и звуковыми сигналами

1. Непредоставление преимущества в движении маршрутному транспортному средству, а равно транспортному средству с одновременно включенными проблесковым маячком синего цвета и специальным звуковым сигналом влечет предупреждение или наложение административного штрафа в размере от ста до трехсот рублей.

2. Непредоставление преимущества в движении транспортному средству, имеющему нанесенные на наружные поверхности специальные цветографические схемы, надписи и обозначения, с одновременно включенными проблесковым маячком синего цвета и специальным звуковым сигналом, влечет наложение административного штрафа в размере от трехсот до пятисот рублей или лишение права управления транспортными средствами на срок от одного до трех месяцев.

Порядок предоставления преимущества ТС с включенными спецсигналами определяется п. 3.2 ПДД, а порядок реализации приоритета в движении маршрутных ТС описан в п. 18 ПДД.

К маршрутным ТС относятся ТС общего пользования (автобус, троллейбус, трамвай), предназначенные для перевозки по дорогам людей и движущиеся по установленному маршруту с обозначенными местами остановок.

Существует спорный вопрос по поводу того, является ли маршрутное такси маршрутным ТС. На этот счет не выработано четкой позиции. Но судя по разъяснениям ГИБДД, водитель должен все-таки уступить маршрутному такси дорогу, когда оно начинает движение от обозначенного места остановки согласно п. 18.3 ПДД. Поэтому советую уступить маршрутке, если она отъезжает от обозначенной соответствующим образом остановки.

По ч. 2 ст. 12.17 КоАП РФ наказывается непредоставление преимущества в движении ТС, имеющему нанесенные на наружные поверхности специальные цветографические схемы, надписи и обозначения, с одновременно включенными проблесковым маячком синего цвета и специальным звуковым сигналом. К таким машинам относятся автомобили скорой помощи, пожарной охраны, МЧС, автомобили полиции. То, каким образом необходимо уступить дорогу подобным автомобилям, изложено в общих положениях ПДД. Понятно, что если вы не уступили дорогу скорой или пожарным, то это очень неблаговидный поступок, так как зачастую здесь счет времени идет на минуты. Но бывают и случаи, когда не слишком добросовестные сотрудники ГИБДД сами провоцируют и организовывают такое нарушение. Например, когда вы едете по дороге, с которой никак невозможно свернуть и где слева и справа препятствия, а движущаяся сзади машина ГИБДД вдруг включила сирену и мигалку. Через минуту вас этот экипаж и останавливает, обвиняя в нарушении ч. 2 ст. 12.17 КоАП РФ. Для защиты своих прав необходимо сфотографировать место нарушения, чтобы четко было видно, что вы никак не могли уступить дорогу. На этапе обжалования необходимо будет сделать запрос в ГИБДД о том, на выполнение какого задания торопилась машина ГИБДД. Для этого обязательно запомните номер этой машины, а еще лучше сфотографируйте его. Сотрудник ГИБДД обязан указать в протоколе об административном правонарушении номер машины со спецсигналами, которую вы не пропустили. Если он не указал эти данные, то у вас есть хорошая возможность обжаловать протокол по процессуальным мотивам. Большую помощь окажут и свидетели. Рассмотрение административного правонарушения по ч. 2 ст. 12.17 КоАП РФ относится к компетенции начальника управления ГИБДД, его заместителя, командиров полка, батальона, роты, их заместителей, но может быть и передано для рассмотрения в суд, что очень часто и происходит. Инкриминируя вам нарушение ч. 2 ст. 12.17 КоАП РФ, сотрудник ГИБДД имеет право изъять ваше водительское удостоверение в порядке ч. 3 ст. 27.10 КоАП РФ и выдать временное. Если суд или должностное лицо решит ограничиться наказанием в виде штрафа, то водительское удостоверение вам обязаны будут вернуть.

С 1 июля 2012 года часть 1 настоящей статьи дополняется частью 1.1: «Движение транспортных средств по полосе для маршрутных транспортных средств или остановка на указанной полосе в нарушение Правил дорожного движения, за исключением случая, предусмотренного частью 1.2 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи пятисот рублей» и частью 1.2: «Нарушение, предусмотренное частью 1.1 настоящей статьи, совершенное в городе федерального значения Москве или Санкт-Петербурге, влечет наложение административного штрафа в размере трех тысяч рублей».

Согласно п. 18.2 ПДД, запрещаются движение и остановка на полосе, предназначенной для движения маршрутных транспортных средств, обозначенной дорожными знаками 5.11, 5.13.1, 5.13.2, 5.14. Исключение: перестроение на полосу при повороте, посадка или высадка пассажиров. Но это лишь в том случае, если полоса отделена прерывистой линией разметки, и водитель не создает помех движению маршрутных транспортных средств. В противном случае, сотрудник ГИБДД вправе привлечь водителя к административной ответственности и наложить штраф в размере 1500 рублей. В случае, если данное правонарушение было совершено в пределах Москвы или Санкт-Петербурга, административный штраф составит 3000 рублей.

Статья 12.18. Непредоставление преимущества в движении пешеходам или иным участникам дорожного движения Невыполнение требования ПДД уступить дорогу пешеходам, велосипедистам или иным участникам дорожного движения (за исключением водителей транспортных средств), пользующимся преимуществом в движении, влечет наложение административного штрафа в размере от восьмисот до одной тысячи рублей.

В п. 14 ПДД указаны случаи, когда водитель ТС должен предоставить преимущество в движении пешеходам. Это нерегулируемый пешеходный переход, который обозначен соответствующими знаками и зеброй. Иногда может быть установлен только знак без нанесения зебры. Сейчас ПДД содержат указание о том, что водитель обязан уступить дорогу пешеходам, переходящим проезжую часть по нерегулируемому пешеходному переходу. Разъяснение понятия «уступить дорогу» содержится в п. 1.2 ПДД: «Участник движения не должен начинать, возобновлять или продолжать движение, осуществлять какой-либо маневр, если это может вынудить других участников движения, имеющих по отношению к нему преимущество, изменить направление движения или скорость». Но и пешеход перед началом перехода проезжей части должен оценить, насколько безопасен для него этот маневр, сумеет ли водитель остановиться или притормозить, чтобы пропустить его.

Полагаю, что дисциплинированный и вежливый водитель все-таки обязан остановиться и пропустить пешехода, который начал движение, ступив на пешеходный переход. И если вы были не правы и вас остановил сотрудник ГИБДД, то признайте вину и впоследствии всегда уступайте дорогу пешеходам, если они имеют преимущество.

Но если вас хотят обвинить несправедливо, например когда пешеход стоял на краю проезжей части и никуда не собирался идти, то попросите сотрудника ГИБДД пригласить пешехода, ведь только он может сказать, заставили ли вы его изменить направление и скорость. Спросите его, начал ли он переход проезжей части.

В том случае, когда сотрудник ГИБДД отказался приглашать пешехода, сославшись, что тот ушел далеко, так и пишите в протоколе: «Состав правонарушения отсутствует – без пешехода доказать, что я не уступил ему дорогу, невозможно. Пешеход просто оступился (звонил по мобильнику, кому-то махал рукой и т. д.) и дорогу не переходил».

Пункт 14.1. ПДД обязывает водителя транспортного средства, приближающегося к нерегулируемому пешеходному переходу, «снизить скорость или остановиться перед переходом, чтобы пропустить пешеходов, переходящих проезжую часть или ступивших на нее для осуществления перехода ».

Когда вы находитесь перед регулируемым пешеходным переходом, прежде чем ехать на разрешающий сигнал светофора или регулировщика, должны убедиться, что все пешеходы, начавшие переход, закончили его. Но это правило касается только тех пешеходов, которые начали переход на разрешающий сигнал. Если сотрудник ГИБДД пытается оштрафовать вас за то, что вы не пропустили пешехода, перебегавшего заведомо на красный свет, то требуйте обязательно, чтобы пешеход был опрошен, а его объяснения приложены к материалам административного дела. Сами запишите в протокол, что пешеход переходил проезжую часть на красный свет.

Пешеходы также имеют преимущество в движении в жилых зонах и на дворовых территориях, но они не должны создавать необоснованных помех ТС.

Водители обязаны уступать дорогу пешеходам, которые идут к остановке маршрутного ТС, расположенной на проезжей части. Обычно на середине проезжей части располагаются остановки трамваев. Так вот, обязанность уступить дорогу пешеходам возникает только с того момента, когда трамвай остановился. И только тогда, когда этот факт подтвержден, может наступить ваша ответственность по ст. 12.18 КоАП РФ.

За непредоставление преимущества участникам дорожного движения полагается штраф, который может быть выписан сотрудником ГИБДД на месте, если вы не оспариваете правонарушение.

Статья 12.19. Нарушение правил остановки или стоянки транспортных средств

1. Нарушение правил остановки или стоянки транспортных средств, за исключением случаев, предусмотренных частью 1 статьи 12.10 настоящего Кодекса и частями 2–4 настоящей статьи, влечет предупреждение или наложение административного штрафа в размере ста рублей.

2. Нарушение правил остановки или стоянки транспортных средств в местах, отведенных для остановки или стоянки транспортных средств инвалидов, влечет наложение административного штрафа на водителя в размере от трех тысяч до пяти тысяч рублей.

3. Остановка или стоянка транспортных средств на пешеходном переходе, за исключением вынужденной остановки, либо нарушение правил остановки или стоянки транспортных средств на тротуаре, повлекшее создание препятствий для движения пешеходов, влечет предупреждение или наложение административного штрафа в размере трехсот рублей.

4. Нарушение правил остановки или стоянки транспортных средств на проезжей части, повлекшее создание препятствий для движения других транспортных средств, а равно остановка или стоянка транспортного средства в тоннеле влечет предупреждение или наложение административного штрафа в размере трехсот рублей.

В ПДД даны определения «остановка», «стоянка транспортных средств» и «вынужденная остановка». Данная статья за нарушение правил остановки и стоянки ТС предусматривает лишь штрафные санкции.

По ч. 1 настоящей статьи наказываются все случаи ненадлежащей стоянки и остановки, которые не оговорены в остальных частях данной статьи и не относятся к ч. 1 ст. 12.10 КоАП РФ. Часть 1 ст. 12.10 КоАП РФ запрещает остановку или стоянку на железнодорожном переезде и предусматривает наказание именно за это нарушение ПДД. Часть 2 ст. 12.19 КоАП РФ предполагает ответственность за нарушение правил остановки и стоянки в местах, отведенных для остановки и стоянки ТС инвалидов. А ч. 3 и 4 ст. 12.19 КоАП РФ предусматривают ответственность за нарушение правил стоянки и остановки, если это повлекло создание препятствий для движения пешеходов и других ТС, а также за остановку и стоянку в тоннеле.

Если вас пытаются привлечь к ответственности по ч. 4 ст. 12.19 КоАП РФ и хотят эвакуировать машину на штрафстоянку, не соглашайтесь с сотрудником ГИБДД. Он должен доказать, что остановка или стоянка повлекла создание помех для движения других ТС. Вы можете сфотографировать или заснять на видео сложившуюся дорожную ситуацию, чтобы было видно, что ваш автомобиль никому не затрудняет движение, расстояние для проезжающих ТС достаточное и они едут по проезжей части свободно.

Иногда по ч. 1 ст. 12.19 КоАП РФ пытаются привлечь водителя к ответственности за стоянку или остановку на так называемых ведомственных стоянках, где установлены таблички «Только для а/м ИФНС», «Только для посетителей заведения» и т. п. Вы можете смело игнорировать такие таблички и оставлять свою машину на стоянке, поскольку в ПДД такие ситуации не регламентированы и, соответственно, запрета ставить машину на стоянку в таких местах нет.

Единственный случай, когда определенному кругу лиц предоставлены преимущества, – это места для остановки и стоянки ТС инвалидов. Они должны быть обозначены специальным знаком (знак дополнительной информации 8.17), и если этого знака нет, то никаких санкций к вам по ч. 2 ст. 12.19 КоАП РФ применено быть не может.

Часть 3 ст. 12.19 КоАП РФ запрещает остановку и стоянку вашего ТС на пешеходном переходе, за исключением вынужденной остановки, а также остановку и стоянку ТС на тротуаре, повлекшие создание помех для движения пешеходов. Использовать тротуар для остановки и стоянки ПДД разрешают только при наличии знака 6.4 «Место стоянки», дополненного одной из табличек 8.6.1–8.6.9, показывающих способ постановки ТС. Для упорядочения размещения ТС на тротуаре в дополнение к соответствующим знакам с помощью разметки 1.1 могут обозначаться границы стояночных мест. В этом случае при постановке ТС на стоянку водители также должны руководствоваться линиями разметки. Пункт 9.9 ПДД допускает движение, а соответственно, и остановку, но не стоянку для загрузки/разгрузки ТС, которое подвозит грузы к торговым точкам, предприятиям, расположенным непосредственно у обочин, тротуаров, пешеходных дорожек. Движение и стоянка в этом случае допускаются только тогда, когда нет иных способов подъезда к данным объектам.

В местах, где отсутствует знак 6.4 с одной из вышеуказанных табличек, стоянка любых ТС на тротуаре запрещена, и действия водителя должны квалифицироваться по ч. 1 ст. 12.19 КоАП РФ, а если остановкой или стоянкой создано препятствие для движения пешеходов, то по ч. 3 этой же статьи. Но то, что препятствия для пешеходов созданы, опять-таки должен доказывать сотрудник ГИБДД. А вам для отстаивания собственной правоты понадобятся свидетели, фото– или видео-съемка, запись в разделе объяснений или на отдельном листе, что вы не создавали препятствий для движения пешеходов.

Часть 4 ст. 12.19 КоАП РФ – одна из самых неприятных для любого водителя в связи с тем, что в этом случае вашу машину могут задержать и эвакуировать на штрафстоянку. Вы должны помнить, что непременным условием для наложения санкций по данной части статьи является создание помех для движения ТС. Следует сказать, что в данном случае не допустить эвакуацию ТС вы можете, устранив причину задержания авто на месте, то есть отъехав туда, где можно припарковаться. Но это должно быть сделано до начала перемещения задерживаемого ТС. Бывают случаи, когда ваше авто эвакуируют без вас. Если вы пришли на то место, где стоял автомобиль, а его там нет, то звоните в дежурную часть УВД, чтобы выяснить, не подверглась ли машина принудительной эвакуации и где ее можно забрать. О задержании и эвакуации ТС сотрудник ГИБДД обязан незамедлительно сообщить в дежурную часть для последующего информирования владельца. Не забывайте, что перемещение на штрафстоянку и первые сутки хранения авто на ней не оплачиваются. Если в процессе эвакуации или хранения машина получила повреждения или пропали какие-либо вещи из салона и багажника, необходимо сразу же вызвать полицию и составить протокол.

Имейте в виду, что, перед тем как эвакуировать машину, сотрудник ГИБДД и водитель эвакуатора опечатывают ее двери, капот и багажник и описывают внешний вид (повреждения, если таковые имеются) в присутствии двух понятых.

С 1 июля 2012 года данная статья претерпевает существенные изменения. Законодатели увеличивают штрафы за каждое правонарушение: в ч. 1 ст. 12.19 КоАП РФ – 300 рублей вместо 100; в ч. 3 – 1000 рублей вместо 300; в ч. 4 – 2000 рублей вместо 300. Также в ч. 1 ст. 12.19 КоАП РФ вместо «частями 2–4 настоящей статьи» будет «частями 2–6 настоящей статьи».

Меняется и содержание ч. 3 данной статьи: «Остановка или стоянка транспортных средств на пешеходном переходе и ближе 5 метров перед ним, за исключением вынужденной остановки и случая, предусмотренного частью 6 настоящей статьи, либо нарушение правил остановки или стоянки транспортных средств на тротуаре, за исключением случая, предусмотренного частью 6 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи рублей».

Кроме этого, статья дополняется четырьмя новыми частями, которые разграничивают административные санкции практически по каждому нарушению остановки или стоянки транспортных средств. Так, с середины 2012 года вступают в силу следующие части.

3.1. Остановка или стоянка транспортных средств в местах остановки маршрутных транспортных средств или ближе 15 метров от мест остановки маршрутных транспортных средств, за исключением остановки для посадки или высадки пассажиров, вынужденной остановки и случаев, предусмотренных частями 4 и 6 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи рублей.

3.2. Остановка или стоянка транспортных средств на трамвайных путях либо остановка или стоянка транспортных средств далее первого ряда от края проезжей части, за исключением вынужденной остановки и случаев, предусмотренных частями 4 и 6 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи пятисот рублей.

5. Нарушение, предусмотренное частью 1 настоящей статьи, совершенное в городе федерального значения Москве или Санкт-Петербурге, влечет наложение административного штрафа в размере двух тысяч пятисот рублей.

6. Нарушения, предусмотренные частями 3–4 настоящей статьи, совершенные в городе федерального значения Москве или Санкт-Петербурге, влекут наложение административного штрафа в размере трех тысяч рублей.

Часть 4 также меняет свое содержание: «Нарушение правил остановки или стоянки транспортных средств на проезжей части, повлекшее создание препятствий для движения других транспортных средств, а равно остановка или стоянка транспортного средства в тоннеле за исключением случая, предусмотренного частью 6 настоящей статьи, влечет наложение административного штрафа в размере двух тысяч рублей».

Согласно ч. 3.1 и 3.2, сотрудник ГИБДД может наложить административное взыскание в виде штрафа за каждое отдельно взятое правонарушение: по ч. 3.1 – за остановку или стоянку на месте остановки маршрутных транспортных средств, по ч. 3.2 – за остановку или стоянку на трамвайных путях или далее первого ряда от края проезжей части. Штрафы за совершение подобных правонарушений также существенные.

Без внимания не остаются города федерального значения Москва и Санкт-Петербург (ч. 5 и ч. 6).

Помимо увеличения штрафных санкций, изменения коснулись и эвакуации транспортных средств на специализированную штрафстоянку. Начиная с июля 2012 года, сотрудники ГИБДД имеют права эвакуировать автомобиль за совершение административных правонарушений, предусмотренных ч. 3–4, 6 ст. 12.19 КоАП РФ. Так, например, если водитель остановился (поставил автомобиль на стоянку) на автобусной остановке, его ожидает не только штраф: транспортное средство будет эвакуировано на штрафстоянку.

Статья 12.20. Нарушение правил пользования внешними световыми приборами, звуковыми сигналами, аварийной сигнализацией или знаком аварийной остановки Нарушение правил пользования внешними световыми приборами, звуковыми сигналами, аварийной сигнализацией или знаком аварийной остановки влечет предупреждение или наложение административного штрафа в размере ста рублей.

Подробно правила использования внешних световых приборов, звуковых сигналов, аварийной сигнализации и знака аварийной остановки регламентированы в ПДД. Наказание за такие нарушения предусмотрено небольшое: предупреждение или штраф в размере 100 рублей. Данное правонарушение рассматривается на месте сотрудником ГИБДД, который может выписать квитанцию в случае, если вы согласны с вменяемым нарушением.

Но если вы не согласны, сотрудник ГИБДД должен составить протокол об административном правонарушении. В протоколе или на отдельном листе вы можете изложить свою версию происшедшего.

Доказать сотрудникам ГИБДД правонарушение по данной статье очень сложно, ведь надо достоверно зафиксировать, что вами был нарушен тот или иной пункт ПДД. А в случае применения световых и звуковых сигналов это могут быть только материалы видеозаписи, показания свидетелей. Причем, как известно, сотрудник полиции (напарник остановившего вас сотрудника ГИБДД) не может быть свидетелем. Не следует забывать о том, что, согласно изменениям в Правилах, в светлое время суток на всех движущихся транспортных средствах с целью их обозначения должны быть включены фары ближнего света или дневные ходовые огни (п. 19.5 ПДД РФ).

Статья 12.24. Нарушение ПДД или правил эксплуатации транспортного средства, повлекшее причинение легкого или средней тяжести вреда здоровью потерпевшего

1. Нарушение ПДД или правил эксплуатации транспортного средства, повлекшее причинение легкого вреда здоровью потерпевшего, влечет наложение административного штрафа в размере от одной тысячи до одной тысячи пятисот рублей или лишение права управления транспортными средствами на срок от одного года до полутора лет.

2. Нарушение ПДД или правил эксплуатации транспортного средства, повлекшее причинение средней тяжести вреда здоровью потерпевшего, влечет наложение административного штрафа в размере от двух тысяч до двух тысяч пятисот рублей или лишение права управления транспортными средствами на срок от полутора до двух лет.

Примечания .

1. Под причинением легкого вреда здоровью следует понимать кратковременное расстройство здоровья или незначительную стойкую утрату общей трудоспособности.

2. Под причинением средней тяжести вреда здоровью следует понимать неопасное для жизни длительное расстройство здоровья или значительную стойкую утрату общей трудоспособности менее чем на одну треть.

Данная статья предусматривает административную ответственность за то, что нарушение вами ПДД или правил эксплуатации ТС повлекло причинение легкого или средней тяжести вреда здоровью потерпевшего. Такие дела рассматриваются начальником управления ГИБДД, его заместителями, командирами полка, батальона, роты, их заместителями либо могут быть переданы в суд, и к вам может быть применена мера в виде штрафа либо лишения прав на тот или иной срок. Причинение тяжкого вреда здоровью потерпевшего будет квалифицироваться уже по нормам Уголовного кодекса РФ.

Для привлечения к ответственности по данной статье необходимо наличие следующих условий.

1. Доказанный факт нарушения вами ПДД или правил эксплуатации ТС.

2. Причинение легкого (ч. 1) или средней тяжести (ч. 2) вреда здоровью потерпевшего в данном ДТП. Потерпевшим может быть признан как водитель другой машины, так и его или ваши пассажиры.

3. Причинная связь между ДТП и причинением вреда здоровью.

Ваша вина в данном происшествии может выражаться как в форме умысла, так и неосторожности, что бывает гораздо чаще.

Медицинские критерии, по которым определяется степень вреда здоровью, регламентированы приказом Минздравсоцразвития РФ от 24.04.2008 № 194 «Об утверждении медицинских критериев определения степени тяжести вреда, причиненного здоровью человека».

Согласно этому приказу легкий вред здоровью – это временное нарушение функций органов и (или) систем (временная нетрудоспособность) продолжительностью до трех недель от момента причинения травмы (до 21 дня включительно) (далее – кратковременное расстройство здоровья), незначительная стойкая утрата общей трудоспособности – стойкая утрата общей трудоспособности менее 10 %.

Следует обратить внимание на то, что поверхностные повреждения, в том числе ссадины, кровоподтеки, ушибы мягких тканей, включающие кровоподтек и гематому, поверхностные раны и другие повреждения, не влекущие за собой кратковременного расстройства здоровья или незначительной стойкой утраты общей трудоспособности, расцениваются как повреждения, не причинившие вред здоровью человека.

Медицинскими критериями квалифицирующих признаков в отношении средней тяжести вреда здоровью являются: временное нарушение функций органов и (или) систем (временная нетрудоспособность) продолжительностью свыше трех недель (более 21 дня) (далее – длительное расстройство здоровья), значительная стойкая утрата общей трудоспособности менее чем на одну треть – стойкая утрата общей трудоспособности от 10 до 30 % включительно.

Эти критерии достаточно четкие, та или иная степень причинения вреда здоровью устанавливается в медицинском учреждении, куда обращается пострадавший. В практике встречаются случаи, когда пострадавший в ДТП не сразу обращается за медицинской помощью. То есть сначала он отказывается от нее, а потом, например на следующий день, может почувствовать себя плохо и обратиться в медучреждение. В этом случае сотрудники медучреждения обязаны сообщить о факте обращения человека за помощью в органы ГИБДД, и тогда уже на виновного в ДТП будет возбуждено дело об административном правонарушении по ст. 12.24 КоАП РФ.

Если произошло ДТП и за рулем автомобиля были вы, не поддавайтесь панике. Если есть пострадавшие, необходимо выяснить, насколько они нуждаются в медицинской помощи, вызвать на место ДТП сотрудников ГИБДД и скорую помощь (если немедленная помощь врачей нужна пострадавшему). Быть может, следует попросить приехать на место ДТП кого-либо из родственников или знакомых, которые могли бы поддержать вас, а заодно проконтролировать, насколько в рамках закона действуют сотрудники ГИБДД.

При рассмотрении дела по ст. 12.24 КоАП РФ в суде представьте своих свидетелей, собранные своими силами доказательства (материалы фото– или видеосъемки, аудиозапись и пр.). Вы имеете право потребовать проведения авто-технической экспертизы, во время которой можете задавать свои вопросы.

Статья 12.25. Невыполнение требования о предоставлении транспортного средства или об остановке транспортного средства

1. Невыполнение требования о предоставлении транспортного средства сотрудникам полиции или иным лицам, которым в случаях, предусмотренных законодательством, предоставлено право использовать транспортные средства, влечет наложение административного штрафа в размере от ста до двухсот рублей.

2. Невыполнение законного требования сотрудника полиции об остановке транспортного средства влечет наложение административного штрафа в размере от двухсот до пятисот рублей.

Право использования вашего ТС может быть применено сотрудниками полиции (причем не только именно сотрудниками ГИБДД) или иными лицами исключительно в оговоренных в законодательстве целях. Об этом говорит и абзац 5 п. 4 Административного регламента: «Сотрудники полиции для выполнения возложенных на них обязанностей имеют право использовать транспортные средства организаций, общественных объединений или граждан для проезда к месту стихийного бедствия, доставления в лечебные учреждения граждан, нуждающихся в срочной медицинской помощи, преследования лиц, совершивших преступления, и доставления их в полицию, а также для транспортировки поврежденных при авариях транспортных средств и проезда к месту происшествия или сбора личного состава полиции по тревоге в случаях, не терпящих отлагательства, с отстранением (пп. 126, 128 Административного регламента) при необходимости водителей от управления этими средствами. Не могут быть использованы транспортные средства, принадлежащие дипломатическим, консульским и иным представительствам иностранных государств, международным организациям, а также транспортные средства специального назначения».

Такое же описание прав сотрудников полиции содержится и в Законе «О полиции».

В случаях, не указанных в законодательстве, использовать ваше ТС сотрудники полиции не имеют права.

При намерении использовать ваше ТС сотрудник полиции обязан вам разъяснить, для какой именно цели будет использовано авто, маршрут движения (кроме случая преследования преступников) и предложить (!) предоставить ваш автомобиль и разъяснить ответственность за отказ.

Санкцией за совершение правонарушения по ч. 1 ст. 12.25 КоАП РФ является штраф от 100 до 200 рублей.

Основания для остановки перечислены в п. 63 Административного регламента:

•  установленные визуально или зафиксированные с использованием технических средств признаки нарушений требований в области обеспечения безопасности дорожного движения;

 наличие данных (ориентировки, информация дежурного, других нарядов, участников дорожного движения, визуально зафиксированные обстоятельства), свидетельствующих о причастности водителя, пассажиров к совершению дорожно-транспортного происшествия, преступления или административного правонарушения;

 наличие данных (ориентировки, сведения оперативно-справочных и разыскных учетов, информация дежурного, других нарядов, участников дорожного движения) об использовании транспортного средства в противоправных целях или оснований полагать, что оно находится в розыске;

•  необходимость опроса водителя или пассажиров об обстоятельствах совершения ДТП, административного правонарушения, преступления, очевидцами которого они являлись или являются;

 необходимость привлечения участника дорожного движения в качестве понятого;

 выполнение распорядительно-регулировочных действий;

 необходимость использования транспортного средства (абзац 5 пункта 4 настоящего Административного регламента);

 необходимость привлечения водителя для оказания помощи другим участникам дорожного движения или сотрудникам милиции;

•  проведение на основании распорядительных актов руководителей органов внутренних дел, органов управления специальных мероприятий, связанных с проверкой в соответствии с целями соответствующих специальных мероприятий транспортных средств, перемещающихся в них лиц и перевозимых грузов;

 проверка документов на право пользования и управления транспортным средством, документов на транспортное средство и перевозимый груз, а также документов, удостоверяющих личность водителя и пассажиров (только на стационарных постах ДПС).

Перечень оснований для остановки ТС не подлежит расширительному толкованию. Стоит обратить особое внимание на то, что проверка документов на право пользования и управления ТС, документов на ТС и перевозимый груз, а также документов, удостоверяющих личность водителя и пассажиров, возможна только на стационарных постах ДПС. Сейчас понятие стационарного поста ДПС содержится в п. 22.4 Наставления об организации комплексного использования сил и средств ОВД РФ по обеспечению правопорядка: «Стационарный пост ДПС (СПДПС) – наряд ДПС ГИБДД, выполняющий задачу в определенном месте, оборудованном специальными служебными помещениями, оснащенном оперативно-техническими и специальными средствами, инженерными и иными сооружениями » и косвенно в п. 14 Административного регламента: «Понятие стационарного поста ДПС включает также контрольный пост полиции и контрольно-пропускной пункт ». Патрульный автомобиль никак не может быть признан постом ДПС, что бы вам ни говорил сотрудник ГИБДД.

Причем когда вас остановили, сотрудник ГИБДД обязан назвать причину остановки.

На дороге служебные обязанности выполняют исключительно сотрудники ГИБДД. Могут ли вас остановить сотрудники других структур полиции? Да, могут. Закон «О полиции» дает им такое право. Это же положение закреплено в ПДД – п. 2.1.1 не делает различия между сотрудниками ГИБДД и другими структурами МВД.

Но такая остановка должна вас насторожить. Для каждой структуры МВД и для каждой должности в приказах четко прописано, когда сотрудник имеет право остановить автомобиль при выполнении им служебных обязанностей (ст. 18 Закона «О полиции»). Например, сотрудник ППС может остановить автомобиль для ограничения доступа в зону оцепления, для проверки документов. Полиции для выполнения возложенных на нее обязанностей предоставляется право производить досмотр ТС (п. 25 ст. 10 Закона «О полиции»). При этом действия сотрудников полиции должны в точности совпадать с действиями сотрудника ГИБДД. Ваши права в разговоре с сотрудником полиции такие же, как в разговоре с сотрудником ГИБДД, поэтому немедленно потребуйте представиться, предъявить документы и назвать причину остановки. Согласно приказу МВД от 02.06.2005 № 444, помимо сотрудников ГИБДД, составлять протоколы по ст. 12.1-12.3, 12.6, 12.7, 12.10–12.20, 12.25, 12.29 КоАП РФ могут другие сотрудники полиции, но только при осуществлении ими своих обязанностей.

Сигнал об остановке должен быть четким и понятным. Если вас пытаются привлечь за то, что не остановились, можете ссылаться на то, что не видели, как подавали сигнал об остановке, либо что вы расценили его как поданный другому ТС. Для доказательства своей правоты вам помогут свидетели.

Статья 12.26. Невыполнение водителем требования о прохождении медицинского освидетельствования на состояние опьянения

1. Невыполнение водителем законного требования сотрудника полиции о прохождении медицинского освидетельствования на состояние опьянения влечет лишение права управления транспортными средствами на срок от полутора до двух лет.

2. Невыполнение водителем, не имеющим права управления транспортными средствами либо лишенным права управления транспортными средствами, законного требования сотрудника полиции о прохождении медицинского освидетельствования на состояние опьянения влечет административный арест на срок до пятнадцати суток или наложение административного штрафа на лиц, в отношении которых в соответствии с настоящим Кодексом не может применяться административный арест, в размере пяти тысяч рублей.

Элементом состава административного правонарушения по ч. 1 и 2 ст. 12.26 КоАП РФ является исключительно отказ от прохождения освидетельствования в медицинском учреждении.

На основании постановления Пленума Верховного Суда РФ от 24.10.2006 № 18 «О некоторых вопросах, возникающих у судов при применении особенной части Кодекса Российской Федерации об административных правонарушениях» отказом может считаться:

• отказ от прохождения освидетельствования, указанный в протоколе о направлении на освидетельствование;

• согласие на прохождение освидетельствования, но отказ от прохождения непосредственно в медицинском учреждении;

• согласие на прохождение освидетельствования, прохождение освидетельствования, но отказ от прохождения одного из видов исследования в рамках освидетельствования.

Обратите внимание на то, что требование сотрудника полиции о прохождении медицинского освидетельствования должно быть законным. Согласно Постановлению № 475 к врачу вас могут направить для прохождения медицинского освидетельствования только в случае:

а) отказа от прохождения освидетельствования на состояние алкогольного опьянения;

б) несогласия с результатами освидетельствования на состояние алкогольного опьянения;

в) наличия достаточных оснований полагать, что водитель ТС находится в состоянии опьянения, и отрицательного результата освидетельствования на состояние алкогольного опьянения.

Все остальные требования сотрудника полиции о прохождении медицинского освидетельствования незаконны. Поэтому, если в отношении вас составлен протокол об административном правонарушении за отказ от прохождения медицинского освидетельствования, следует обращать внимание на основания, по которым вы должны были быть направлены для его прохождения. Эти основания указываются в соответствующем протоколе о направлении на медицинское освидетельствование, а также непосредственно в протоколе об административном правонарушении. Обращайте внимание на то, что именно вы подписываете. Если протокол не заполнен, а сотрудник ГИБДД просит его подписать, не соглашайтесь.

Необходимо обращать внимание на все документы, которые будут составлены в отношении вас. Все документы в соответствии со ст. 26.2 КоАП РФ выступают в качестве доказательств по делу об административном правонарушении и должны отвечать требованиям допустимости. В соответствии с ч. 3 ст. 26.2 КоАП РФ не допускается использование доказательств, полученных с нарушением закона. Так как все протоколы на данный момент составляются сотрудниками ГИБДД, то они часто допускают ошибки при их составлении. При отказе от прохождения медицинского освидетельствования составляются следующие документы:

• протокол об отстранении от управления ТС;

• акт освидетельствования;

• протокол о направлении на медицинское освидетельствование;

• протокол об административном правонарушении;

• протокол о задержании ТС;

• протокол о помещении ТС на специальную стоянку.

Дело об этом правонарушении для рассмотрения должно

быть направлено мировому судье.

Отказ от выполнения законного требования сотрудника полиции о прохождении медицинского освидетельствования на состояние опьянения – это нарушение п. 2.3.2 ПДД.

Освидетельствование на состояние алкогольного опьянения может проводиться сотрудником ГИБДД на месте, и вы можете от него отказаться. Но такой отказ квалифицироваться по ст. 12.26 КоАП РФ не может!

Представление впоследствии в суд водителем, который отказался от прохождения медицинского освидетельствования, акта освидетельствования, опровергающего факт его нахождения в состоянии опьянения, само по себе не свидетельствует о незаконности требования сотрудника полиции. Судье в указанном случае необходимо учитывать обстоятельства отказа от прохождения медицинского освидетельствования, временной промежуток между отказом от освидетельствования и прохождением освидетельствования по инициативе самого водителя, соблюдение правил проведения такого освидетельствования и т. п.

Никогда не пишите в графе «Объяснения» в протоколе об административном правонарушении подобные фразы: «тороплюсь», «на освидетельствование не поехал, потому что не было времени», «не видел в этом смысла» и т. д. Такие объяснения в ходе судебного заседания будут приняты как причина отказа от освидетельствования, а это, разумеется, сыграет не в вашу пользу.

Часть 2 ст. 12.26 КоАП РФ имеет более сложный состав и предусматривает наказание за невыполнение требования сотрудника полиции о прохождении медицинского освидетельствования водителем, не имеющим права управления ТС либо лишенным такого права. За такое правонарушение положен административный арест на срок до 15 суток либо наложение административного штрафа на лиц, к которым не может быть применен административный арест. Перечень лиц, к которым не может быть применен административный арест, установлен ст. 3.9 КоАП РФ. Административный арест не может применяться к беременным женщинам, женщинам, имеющим детей в возрасте до четырнадцати лет, лицам, не достигшим возраста восемнадцати лет, инвалидам I и II групп, военнослужащим, гражданам, призванным на военные сборы, а также к имеющим специальные звания сотрудникам органов внутренних дел, органов и учреждений уголовно-исполнительной системы, Государственной противопожарной службы, органов по контролю за оборотом наркотических средств и психотропных веществ и таможенных органов.

При привлечении к ответственности по ч. 2 ст. 12.26 КоАП РФ в практике встречаются случаи, когда сотрудники ГИБДД пытаются применить административное задержание. Если имеются достаточные основания для того, чтобы задержать водителя, сотрудник полиции обязан составить протокол о задержании на основании ч. 1 ст. 27.4 КоАП РФ.

Согласно ч. 1 ст. 27.3 КоАП РФ административное задержание, то есть кратковременное ограничение свободы физического лица, может быть применено в исключительных случаях, если это необходимо для обеспечения правильного и своевременного рассмотрения дела об административном правонарушении, исполнения постановления по делу об административном правонарушении.

О том, что мотивы задержания должны быть указаны в протоколе об административном задержании, говорится в ч. 1 ст. 27.4 КоАП РФ.

Следует помнить, что задержание и арест – разные процессуальные действия. Если решение о задержании принимается сотрудником полиции, то административный арест может производиться исключительно по решению суда.

Задержание гражданина согласно ч. 2 ст. 27.5 КоАП РФ может производиться на срок до 48 часов, а административный арест – до 15 суток.

Если гражданин совершил правонарушение, за которое грозит административный арест, задерживать его вовсе не обязательно. Верховный Суд РФ отметил, что возможный арест в качестве наказания за обнаруженное правонарушение не является мотивом для задержания. Доводы сотрудников полиции о том, что задержание необходимо для обеспечения присутствия гражданина при рассмотрении дела, не могут быть приняты судом, если гражданин сможет доказать, что уклоняться от явки в суд он не собирался. В этом случае судья может назначить административный арест на срок незаконного задержания. Срок задержания входит в административный арест (п. 3 ст. 3.9 КоАП РФ). Разумеется, что само задержание могло быть незаконным, однако для гражданина самое главное – побыстрее вернуться домой, и о таких мелочах он больше не думает, лишь бы ничего не добавили.

Отсутствие судьи на месте также не является мотивом для задержания. В постановлении Верховного Суда от 11.04.2005 № 7-АД04-2 указано: «Сам по себе факт составления в отношении лица протокола об административном правонарушении, за которое может быть назначено наказание в виде административного ареста, не может служить основанием для административного задержания лица ». Таким образом, если водителя задержали поздно вечером, когда рабочий день суда уже закончился, это не может стать основанием для задержания.

Если человека задержали, то согласно ст. 27.3 КоАП РФ по просьбе лица, задержанного за совершение административного правонарушения, о месте его нахождения уведомляются родственники, администрация по месту работы или учебы, а также защитник, если таковой имеется.

Задержанный в нетрезвом состоянии гражданин должен помнить, что срок его задержания согласно ч. 4 ст. 27.5 КоАП РФ начнет исчисляться только с момента вытрезвления, поэтому несколько часов будут проведены им, как говорится, за свой счет.

Если судья вынес решение об административном аресте, то такое решение, согласно ст. 32.8 КоАП РФ, подлежит немедленному исполнению. Гражданин вправе сразу же написать жалобу, и она на основании ч. 2 ст. 30.2 КоАП РФ будет передана в вышестоящий суд в течение суток. В течение этих же суток на основании ч. 3 ст. 30.5 КоАП РФ жалоба должна быть рассмотрена судом.

Статья 12.27. Невыполнение обязанностей в связи с дорожно-транспортным происшествием

1. Невыполнение водителем обязанностей, предусмотренных ПДД, в связи с дорожно-транспортным происшествием, участником которого он является, за исключением случаев, предусмотренных частью 2 настоящей статьи, влечет наложение административного штрафа в размере одной тысячи рублей.

2. Оставление водителем в нарушение ПДД места дорожно-транспортного происшествия, участником которого он являлся, влечет лишение права управления транспортными средствами на срок от одного года до полутора лет или административный арест на срок до пятнадцати суток.

3. Невыполнение требования ПДД о запрещении водителю употреблять алкогольные напитки, наркотические или психотропные вещества после дорожно-транспортного происшествия, к которому он причастен, либо после того, как транспортное средство было остановлено по требованию сотрудника полиции, до проведения уполномоченным должностным лицом освидетельствования в целях установления состояния опьянения или до принятия уполномоченным должностным лицом решения об освобождении от проведения такого освидетельствования влечет лишение права управления транспортными средствами на срок от полутора до двух лет.

Для наступления ответственности по этой статье неважно, является ли виновником ДТП привлекающийся по ней водитель. Для возникновения состава административного правонарушения важно, чтобы это был участник ДТП. Определение ДТП дано в п. 1.2 ПДД – это «событие, возникшее в процессе движения по дороге транспортного средства и с его участием, при котором погибли или ранены люди, повреждены транспортные средства, сооружения, грузы, либо причинен иной материальный ущерб».

Обязанности водителя – участника ДТП изложены в п. 2.5 ПДД. Водитель – участник ДТП обязан остановить (не трогать с места) свое ТС, включить аварийку и выставить знак аварийной остановки. Ничего не трогать на месте происшествия (не убирать осколки стекол, детали машин). Пострадавшим в ДТП нужно оказать первую медицинскую помощь, вызвать скорую, в случае необходимости отправить пострадавших на попутном либо отвезти их на своем ТС в ближайшую больницу, затем вернуться на место происшествия. Если движение других ТС невозможно, то водитель должен освободить проезжую часть. При этом, как и в случае вынужденного отъезда с места происшествия в больницу, он должен предварительно зафиксировать положение своего ТС в присутствии свидетелей, следы и предметы, относящиеся к происшествию, принять все возможные меры к организации объезда места происшествия.

Конечно же, водителю необходимо сообщить о ДТП в дежурную часть ГИБДД либо по телефону экстренных служб, откуда информация будет передана по назначению. Вы обязаны ожидать прибытия сотрудников полиции на место ДТП, записать телефоны, адреса, фамилии очевидцев.

В случае невыполнения этих обязанностей вы можете быть подвергнуты административной ответственности по ч. 1 ст. 12.27 КоАП РФ. Это будет штраф в размере 1000 рублей.

Пункт 2 комментируемой статьи предполагает ответственность за оставление водителем – участником ДТП места происшествия. Оставлением места ДТП не будет являться:

• невыполнение требований участников дорожного движения в части перестановки автомобиля с целью освобождения полосы для движения ТС. ПДД регламентирует такую возможность, однако предписывает в присутствии свидетелей зафиксировать положение ТС до момента его перемещения, следы, предметы;

• доставление пострадавшего в больницу на собственном автомобиле. После этих действий водитель обязан вернуться на место совершения ДТП;

• если водители ТС, оценив обстоятельства, составив схему ДТП и подписав ее, едут с места ДТП на ближайший пост ДПС или в орган ГИБДД для оформления ДТП.

Формально оставлением места ДТП является отсутствие гражданина в момент оформления происшествия сотрудниками ГИБДД. Если вы уехали или ушли с места ДТП, но вернулись к моменту оформления, это не будет являться нарушением. При всем сказанном п. 2.5 ПДД обязывает участников ДТП ожидать прибытия сотрудников ГИБДД, но не указывает на временной промежуток ожидания и место, где оно должно происходить.

Если второй участник предпочел не вызывать ГАИ и рассчитался с вами на месте, обменяйтесь расписками, которые должны содержать следующий текст: «В результате того, что таким-то водителям показалось, что автомобили получили повреждения в возможном ДТП, они осмотрели их и, не обнаружив следов, указывающих на факт совершения ДТП, продолжили движение. Необходимости в вызове полиции не имелось. Стороны претензий друг к другу не имеют».

Но возможен и такой случай. На парковке водитель зацепил стоящий рядом автомобиль и, понадеявшись, что данного события никто не видел, уехал. Когда сотрудники ГИБДД по свидетельским показаниям нашли данного водителя, он договорился о добровольной компенсации лицу, которому его действиями был причинен ущерб. Таким образом, исчерпан только конфликт между двумя гражданами, но дело об административном правонарушении уже возбуждено и забрать свое заявление о совершении ДТП потерпевший не может, поскольку виновного привлекли за факт административного правонарушения, выраженного в оставлении места ДТП.

Если вас вызвали в ГИБДД для оформления протокола о факте скрытия с места ДТП, будьте внимательны. Потребуйте проведения экспертизы и эксперимента с целью установления обстоятельства, подтверждающего, что подобное действительно могло иметь место с участием конкретных автомобилей. Если вам предлагается подписать схему или иные материалы, никогда не отказывайтесь от этого. Укажите, что не согласны, и поставьте свою подпись. Обязательно сделайте копию или сфотографируйте документ, потому что в любой документ, копию которого гражданин не получает, можно в дальнейшем внести различные удобные для одной из сторон изменения.

За оставление места ДТП предусмотрено более серьезное наказание: либо лишение права управления, либо административный арест на срок до 15 суток. Административное дело по ч. 2 ст. 12.27 КоАП РФ будет рассматриваться в суде. Здесь доказательствами служат свидетельские показания, что именно ваш автомобиль видели на месте ДТП, данные экспертизы о том, что этот автомобиль участвовал в ДТП. Но необходимо также доказать, что за рулем автомобиля были именно вы, а не тот человек, кому вы передали автомобиль по доверенности.

Срок давности для рассмотрения такого дела составляет два месяца, решение судьи по делу может быть обжаловано вами в вышестоящих судебных инстанциях.

Статья 12.28. Нарушение правил, установленных для движения транспортных средств в жилых зонах Нарушение правил, установленных для движения транспортных средств в жилых зонах, влечет наложение административного штрафа в размере пятисот рублей.

Возникновение дорожно-транспортных происшествий, в которых потерпевшими являются пешеходы, все чаще переходит с проезжей части в жилые зоны. Согласно п. 17.1 ПДД, жилой зоной является территория, въезды и выезды на которую обозначаются дорожными знаками 5.21 и 5.22. К жилой зоне также приравниваются дворовые территории. В жилой зоне пешеходы имеют преимущество перед транспортными средствами, хотя и не должны создавать им помех.

В п. 17.2 ПДД четко прописаны запрещенные действия: «сквозное движение, учебная езда, стоянка с работающим двигателем, а также стоянка грузовых автомобилей с разрешенной максимальной массой более 3,5 т вне специально выделенных и обозначенных знаками и (или) разметкой мест». За несоблюдение данных предписаний сотрудник ГИБДД вправе привлечь водителя к административной ответственности и взыскать с него штраф в размере 500 рублей.

Не стоит забывать, что для того, чтобы сотрудник ГИБДД смог составить протокол о совершенном вами административном правонарушении или выписать вам постановление-квитанцию об уплате штрафа, ему необходимо предоставить доказательства. В частности, к таким доказательствам относится фото– или видеофиксация совершенных противоправных действий, свидетельские показания очевидцев либо самих пешеходов, дорогу которым вы не уступили в жилой зоне. При отсутствии доказательств вы можете не соглашаться с вменяемым вам правонарушением и спокойно писать в протоколе «Не согласен». На судебном заседании без наличия вещественных доказательств совершенного противоправного деяния судья примет решение в вашу пользу.

С 1 июля 2012 года статья 12.28 КоАП РФ будет изменена и дополнена. В частности, статья, не имеющая составных частей, будет разделена.

1. Нарушение правил, установленных для движения транспортных средств в жилых зонах, за исключением случая, предусмотренного частью 2 настоящей статьи, влечет наложение административного штрафа в размере пятисот рублей.

2. Нарушение, предусмотренное частью 1 настоящей статьи, совершенное в городе федерального значения Москве или Санкт-Петербурге, влечет наложение административного штрафа в размере трех тысяч рублей .

Законодатель выделил административное правонарушение данной статьи в отдельную часть для городов федерального значения специально, дабы сократить количество ДТП, совершаемых в жилых зонах.

Статья 12.36.1. Нарушение правил пользования телефоном водителем транспортного средства Пользование водителем во время движения транспортного средства телефоном, не оборудованным техническим устройством, позволяющим вести переговоры без использования рук, влечет предупреждение или наложение административного штрафа в размере трехсот рублей.

Прежде всего следует сказать, что разговор по телефону во время движения – мощный отвлекающий фактор, способствующий возникновению аварийных ситуаций и ДТП. Поэтому следует воздерживаться от использования телефона во время движения, сосредоточьтесь лучше на дороге.

Но наличие события данного административного правонарушения является сложно доказуемым, видимо, поэтому оно встречается в практике не очень часто. Факт того, что вы использовали телефон, не оборудованный устройством для проведения переговоров без помощи рук, должен быть подтвержден надлежащим образом – при помощи фото– или видеоматериала, свидетеля. Вряд ли такие доказательства может представить сотрудник ГИБДД, остановивший вас и намеревающийся привлечь к ответственности по ст. 12.36.1 КоАП РФ.

Тем более что для возникновения состава административного правонарушения нужно доказать факт пользования телефоном. В случае если вы будете отрицать этот факт, да еще у вас будет и свидетель, который скажет, что телефоном вы не пользовались, привлечь к ответственности по данной статье будет очень сложно.

Статья 12.37. Несоблюдение требований об обязательном страховании гражданской ответственности владельцев транспортных средств

1. Управление транспортным средством в период его использования, не предусмотренный страховым полисом обязательного страхования гражданской ответственности владельцев транспортного средства, а равно управление транспортным средством с нарушением предусмотренного данным страховым полисом условия управления этим транспортным средством только указанными в данном страховом полисе водителями, влечет наложение административного штрафа в размере трехсот рублей.

2. Неисполнение владельцем транспортного средства установленной федеральным законом обязанности по страхованию своей гражданской ответственности, а равно управление транспортным средством, если такое обязательное страхование заведомо отсутствует, влечет наложение административного штрафа в размере от пятисот до восьмисот рублей.

В России по части обязательного страхования гражданской ответственности действует Закон «Об обязательном страховании гражданской ответственности владельцев транспортных средств» от 25.04.2002 № 40-ФЗ с последующими изменениями и дополнениями, а также Правила обязательного страхования гражданской ответственности владельцев транспортных средств, утвержденные постановлением Правительства РФ от 07.05.2003 № 263, также с последующими изменениями.

Большинство ТС подлежит страхованию по ОСАГО, но есть и исключения, о которых указано в Правилах ОСАГО: «Обязательному страхованию в соответствии с настоящими Правилами не подлежит риск гражданской ответственности владельцев транспортных средств:

а) максимальная конструктивная скорость которых составляет не более 20 км/ч;

б) на которые по их техническим характеристикам не распространяются положения законодательства Российской Федерации о допуске транспортных средств к участию в дорожном движении на территории Российской Федерации;

в) которые находятся в распоряжении Вооруженных Сил Российской Федерации, за исключением автобусов, легковых автомобилей и прицепов к ним, иных транспортных средств, используемых для обеспечения хозяйственной деятельности Вооруженных Сил Российской Федерации;

г) зарегистрированных в иностранных государствах, если гражданская ответственность владельцев таких транспортных средств застрахована в рамках международных систем страхования гражданской ответственности владельцев транспортных средств, участником которых является профессиональное объединение страховщиков, действующее в соответствии с Федеральным законом „Об обязательном страховании гражданской ответственности владельцев транспортных средств”;

д) в части, касающейся принадлежащих гражданам прицепов к легковым автомобилям».

Часть 1 настоящей статьи предусматривает административную ответственность за те случаи, когда у вас есть полис ОСАГО, но он имеет определенные погрешности. Речь идет об управлении ТС в период его использования, не предусмотренный полисом. Следует различать срок действия договора ОСАГО и период разрешенного использования ТС. Договор страхования ОСАГО заключается на один год, но уже внутри этого срока вы можете оплатить период использования ТС, равный трем месяцам, если, например, ездите только летом. Так вот, если в графе полиса «Срок действия договора» стоит, например, с 01.07.2010 по 30.06.2011, а в графе «Период использования ТС» значится с 01.07.2010 по 01.10.2010, то, выехав 02.10.2010 и попавшись для проверки сотруднику ГИБДД, вы рискуете получить штраф по ч. 1 ст. 12.37 КоАП РФ. Бывают случаи, когда особо «доблестные» сотрудники ГИБДД пытаются за это правонарушение наказать по ч. 2 данной статьи, но тут вы должны сразу заявить, что не согласны, так как полис ОСАГО есть, записать это в протоколе, указав серию и номер полиса, а сотруднику ГИБДД пояснить, что будете не только обжаловать протокол, а напишете жалобу на его действия в прокуратуру.

Под ответственность по ч. 1 ст. 12.37 КоАП РФ подпадает также случай, когда автомобилем управляет не вписанный в полис ОСАГО водитель. Данное нарушение очевидно и будет обнаружено при первой же проверке документов, поэтому здесь можно только порекомендовать вовремя вписывать в полис ОСАГО водителей, которые будут управлять вашим автомобилем.

Часть 2 содержит более серьезные наказания, к тому же при данном правонарушении запрещается эксплуатация ТС, а номера подлежат снятию и могут быть выданы только после устранения причины запрещения эксплуатации. Рассмотрим указанные в ч. 2 составы административных правонарушений.

Управление ТС, если полис ОСАГО заведомо отсутствует. Но в этой ситуации сотрудник ГИБДД должен доказать заведомость этого правонарушения, то есть то, что вы знали, что полиса ОСАГО на данный автомобиль нет, но тем не менее сели за руль.

Если вы управляете машиной по доверенности, попробуйте объяснить сотруднику ГИБДД, что полис есть, просто владелец, видимо, забыл передать его вам вместе с документами на автомобиль.

Постановление Пленума ВС РФ от 24.10.2006 № 18 с изменениями гласит, что «в тех случаях, когда владелец транспортного средства выполнил обязанность по страхованию своей гражданской ответственности, однако на момент проведения проверки у водителя отсутствовал страховой полис, его действия следует квалифицировать по части 2 статьи 12.3 КоАП РФ. При этом водитель несет административную ответственность независимо от того, управляет ли он транспортным средством по доверенности, договору аренды либо на ином законном основании».

В случае если вы владелец ТС и у вас нет полиса ОСАГО, то тут просматривается еще и состав «неисполнения владельцем ТС установленной обязанности по страхованию своей гражданской ответственности». Если у вас хватит смелости и напора, попробуйте также сказать, что полис есть, просто вы его забыли. В случае если сотрудник ГИБДД будет настаивать на том, что сначала накажет вас, а потом вы представите полис и правонарушение будет переквалифицировано, можно возразить, что все сомнения должны толковаться в пользу лица, привлекаемого к административной ответственности, да и презумпцию невиновности никто не отменял. Доказательств правонарушения по ч. 2 ст. 12.37 КоАП РФ у сотрудника ГИБДД не имеется, приносить что-либо и доказывать в данном случае, что не виновны, вы не обязаны. Может, поддавшись вашему напору, сотрудник ГИБДД и отступит, но если он окажется более упрямым, а у вас на самом деле нет полиса ОСАГО, тогда наказание по ч. 2 ст. 12.37 КоАП РФ будет правомерным.

Применение мер обеспечения производства по делам об административных правонарушениях

Статья 27.7. Личный досмотр, досмотр вещей, находящихся при физическом лице

1. Личный досмотр, досмотр вещей, находящихся при физическом лице, то есть обследование вещей, проводимое без нарушения их конструктивной целостности, осуществляются в случае необходимости с целью обнаружения орудий совершения либо предметов административного правонарушения.

2. Личный досмотр, досмотр вещей, находящихся при физическом лице, осуществляются должностными лицами, указанными в статьях27.2, 27.3 настоящего Кодекса.

3. Личный досмотр производится лицом одного пола с досматриваемым в присутствии двух понятых того же пола.

Досмотр вещей, находящихся при физическом лице (ручной клади, багажа, орудий охоты и рыболовства, добытой продукции и иных предметов), осуществляется уполномоченными на то должностными лицами в присутствии двух понятых.

4. В исключительных случаях при наличии достаточных оснований полагать, что при физическом лице находятся оружие или иные предметы, используемые в качестве оружия, личный досмотр, досмотр вещей, находящихся при физическом лице, могут быть осуществлены без понятых.

5. В случае необходимости применяются фото– и киносъемка, видеозапись, иные установленные способы фиксации вещественных доказательств.

6. О личном досмотре, досмотре вещей, находящихся при физическом лице, составляется протокол либо делается соответствующая запись в протоколе о доставлении или в протоколе об административном задержании. В протоколе о личном досмотре, досмотре вещей, находящихся при физическом лице, указываются дата и место его составления, должность, фамилия и инициалы лица, составившего протокол, сведения о физическом лице, подвергнутом личному досмотру, о виде, количестве, об иных идентификационных признаках вещей, в том числе о типе, марке, модели, калибре, серии, номере, об иных идентификационных признаках оружия, о виде и количестве боевых припасов, о виде и реквизитах документов, обнаруженных при досмотре, находящихся при физическом лице.

7. В протоколе о личном досмотре, досмотре вещей, находящихся при физическом лице, делается запись о применении фото– и киносъемки, видеозаписи, иных установленных способов фиксации вещественных доказательств. Материалы, полученные при осуществлении личного досмотра, досмотра вещей, находящихся при физическом лице, с применением фото– и киносъемки, видеозаписи, иных установленных способов фиксации вещественных доказательств, прилагаются к соответствующему протоколу.

8. Протокол о личном досмотре, досмотре вещей, находящихся при физическом лице, подписывается должностным лицом, его составившим, лицом, в отношении которого ведется производство по делу об административном правонарушении, либо владельцем вещей, подвергнутых досмотру понятыми. В случае отказа лица, в отношении которого ведется производство по делу, владельца вещей, подвергнутых досмотру, от подписания протокола в нем делается соответствующая запись. Копия протокола о личном досмотре, досмотре вещей, находящихся при физическом лице, вручается владельцу вещей, подвергнутых досмотру, по его просьбе.

Положения данной статьи полностью воспроизводятся и в Административном регламенте, которым должны руководствоваться сотрудники ГИБДД при осуществлении своей деятельности.

Основаниями для личного досмотра и досмотра вещей, находящихся при вас, могут быть осуществление административного задержания или наличие достаточных оснований полагать, что у вас могут находиться оружие, боеприпасы, наркотики, психотропные вещества, взрывные устройства, взрывчатые вещества, а также орудия совершения либо предметы административного правонарушения.

Конечно, достаточность оснований для проведения личного досмотра и досмотра вещей, к сожалению, не определена законодательно, поэтому часто трактуется сотрудниками ГИБДД весьма вольно. Поэтому, если вам грозит личный досмотр или досмотр вещей, следует придерживаться нескольких правил.

1. Сотрудник, производящий личный досмотр, должен быть одного с вами пола. Также одного с вами пола должны быть понятые, присутствующие при осмотре. Число понятых должно быть не менее двух. Административный кодекс допускает проведение досмотра вас или ваших вещей без понятых, но только в исключительных случаях при наличии достаточных оснований предполагать, что при вас находятся оружие либо предметы, которые можно использовать как оружие.

2. Если не проводится административное задержание с доставлением, сотрудник ГИБДД может только предложить лично предъявить ему содержимое ваших карманов, сумок и пр.

3. Если вы опасаетесь, что в карман или сумку что-то подбросили, не дотрагивайтесь до этого предмета руками. Еще до проведения досмотра сделайте заявление о том, что предполагаете, что вам могут быть подброшены запрещенные предметы или вещества. Если все-таки нашли то, что вам не принадлежит, не дотрагивайтесь до этого предмета руками. В протоколе досмотра обязательно укажите, что этот предмет не ваш. И даже если вы понимаете, что это пакетик с наркотиками либо оружие, описывайте его так, как будто не знаете, о чем идет речь. Например, «целлофановый пакетик с белым содержимым мне не принадлежит».

4. О личном досмотре и досмотре вещей обязательно должен быть составлен протокол либо сделана запись в протоколе об административном задержании или доставлении. Протокол должен содержать в обязательном порядке сведения, указанные в ч. 6 и 7 настоящей статьи. Потребуйте выдать копию протокола. Если вы не сделаете этого, то сотрудник ГИБДД может и не выдать вам копию. Ведь согласно ч. 8 комментируемой статьи «Копия протокола о личном досмотре, досмотре вещей, находящихся при физическом лице, вручается владельцу вещей, подвергнутых досмотру, по его просьбе ».

Статья 27.9. Досмотр транспортного средства

1. Досмотр транспортного средства любого вида, то есть обследование транспортного средства, проводимое без нарушения его конструктивной целостности, осуществляется с целью обнаружения орудий совершения либо предметов административного правонарушения.

2. Досмотр транспортного средства осуществляется лицами, указанными в статьях 27.2, 27.3 настоящего Кодекса, в присутствии двух понятых.

3. Досмотр транспортного средства осуществляется в присутствии лица, во владении которого оно находится. В случаях, не терпящих отлагательства, досмотр транспортного средства может быть осуществлен в отсутствие указанного лица.

4. В случае необходимости применяются фото– и киносъемка, видеозапись, иные установленные способы фиксации вещественных доказательств.

5. О досмотре транспортного средства составляется протокол либо делается соответствующая запись в протоколе об административном задержании.

6. В протоколе о досмотре транспортного средства указываются дата и место его составления, должность, фамилия и инициалы лица, составившего протокол, сведения о лице, во владении которого находится транспортное средство, подвергнутое досмотру, о типе, марке, модели, государственном регистрационном номере, об иных идентификационных признаках транспортного средства, о виде, количестве, об иных идентификационных признаках вещей, в том числе о типе, марке, модели, калибре, серии, номере, об иных идентификационных признаках оружия, о виде и количестве боевых припасов, о виде и реквизитах документов, обнаруженных при досмотре транспортного средства.

7. В протоколе о досмотре транспортного средства делается запись о применении фото– и киносъемки, видеозаписи, иных установленных способов фиксации вещественных доказательств. Материалы, полученные при осуществлении досмотра с применением фото– и киносъемки, видеозаписи, иных установленных способов фиксации вещественных доказательств, прилагаются к соответствующему протоколу.

8. Протокол о досмотре транспортного средства подписывается должностным лицом, его составившим, лицом, в отношении которого ведется производство по делу об административном правонарушении, и (или) лицом, во владении которого находится транспортное средство, подвергнутое досмотру, понятыми. В случае отказа лица, в отношении которого ведется производство по делу об административном правонарушении, и (или) лица, во владении которого находится транспортное средство, подвергнутое досмотру, от подписания протокола в нем делается соответствующая запись. Копия протокола о досмотре транспортного средства вручается лицу, во владении которого находится транспортное средство, подвергнутое досмотру.

Положения о порядке досмотра ТС содержатся и в Административном регламенте. Основаниями для досмотра ТС, согласно Административному регламенту, являются:

• ориентировки, указания в соответствии с целями проведения специальных мероприятий;

• отказ водителя или граждан, сопровождающих грузы, от проведения осмотра ТС и перевозимого груза;

• проверка обоснованного предположения о наличии в ТС оружия, боеприпасов, взрывчатых веществ, взрывных устройств, наркотических средств или психотропных веществ, других вещей, предметов и веществ, изъятых из гражданского оборота и находящихся у граждан без специального разрешения, орудий совершения либо предметов преступления;

• проверка обоснованного предположения о наличии в ТС орудий совершения либо предметов административного правонарушения.

Иных оснований быть не должно. Перед досмотром сотрудник ГИБДД должен предложить вам добровольно выдать имеющиеся в ТС предметы, оружие, боеприпасы, наркотики и в случае отказа произвести досмотр, пригласив двух понятых и разъяснив им их права и обязанности по участию в досмотре. Досмотр ТС может проводиться в присутствии двух понятых, а также владельца ТС. Сотрудники ГИБДД ни при каких обстоятельствах не могут выступать в качестве понятых. И только в случаях, не терпящих отлагательства, досмотр ТС может быть осуществлен в отсутствие владельца. Если вы не владелец ТС, требуйте присутствия владельца для соблюдения всех норм закона.

О том, проводятся ли какие-либо специальные мероприятия, участвует ли в проведении таких мероприятий сотрудник ГИБДД, остановивший вас, и является ли он вообще сотрудником, а не мошенником, вы можете узнать в дежурной части, позвонив туда по телефону, который лучше всегда иметь под рукой.

Кроме сотрудников Госавтоинспекции и дорожного надзора, досмотр ТС могут осуществлять сотрудники органов внутренних дел, военнослужащие и другие представители внутренних войск МВД РФ, представители охраны (ведомственной или вневедомственной), работающие в ОВД, представители органов по надзору и контролю за выполнением требований законодательства по охране окружающей среды, представители военной автомобильной инспекции, военнослужащие – пограничники или другие представители ОВД, на которых возложена обязанность охраны Государственной границы РФ, сотрудники дорожно-строительных и инженерно-технических воинских частей.

О досмотре ТС составляется протокол, его копия в обязательном порядке вручается лицу – владельцу автомобиля. Данные, которые в обязательном порядке заносятся в протокол, указаны в п. 163 Административного регламента и в ч. 6.7 ст. 27.9 КоАП РФ.

Если намереваются произвести досмотр груза, который находится в вашем автомобиле (здесь речь идет именно о грузе, находящемся в грузовом автомобиле, а не о багаже пассажиров легкового ТС), то надо помнить о следующих правилах. В случае когда вы везете опломбированный груз либо груз, находящийся под таможенным контролем, сотрудник обязан позвонить в дежурную часть и действовать по полученным там указаниям. Лишь в случае крайней необходимости (ст. 2.7 КоАП РФ) опломбированный груз может быть досмотрен сотрудником с привлечением двух понятых без звонка в дежурную часть. Но груз, находящийся под таможенным контролем, так досматривать нельзя.

Во время досмотра как сотрудники ГИБДД, так и вы можете вести видео-, фотосъемку и аудиозапись происходящего. Это поможет в случае необходимости доказать тот факт, что на вас оказывалось давление со стороны сотрудников ГИБДД.

Досмотр ТС должен проводиться только после того, как вы и пассажиры выйдете из машины. Если в ходе досмотра обнаружены признаки преступления, сотрудник обязан об этом доложить в дежурную часть для решения вопроса о направлении следственно-оперативной группы, доставлении лиц, перемещении ТС в расположение органа внутренних дел. Также обязательно должен быть составлен рапорт по факту обнаружения признаков преступления.

Частое требование сотрудников ГИБДД открыть багажник – это уже попытка провести досмотр автомобиля, а не осмотр. Осмотр – это визуальное обследование автомобиля. При осмотре сотрудник ГИБДД может через стекло заглянуть в салон, сверить маркировочные обозначения ТС с записями в документах на него, осмотреть внешний вид автомобиля и не более.

Статья 27.12. Отстранение от управления транспортным средством, освидетельствование на состояние алкогольного опьянения и медицинское освидетельствование на состояние опьянения

1. Лицо, которое управляет транспортным средством соответствующего вида и в отношении которого имеются достаточные основания полагать, что это лицо находится в состоянии опьянения, а также лица, совершившие административные правонарушения, предусмотренные частью 1 статьи 12.3, частью 2 статьи 12.5, частями 1 и 2 статьи 12.7 настоящего Кодекса, подлежат отстранению от управления транспортным средством до устранения причины отстранения.

1.1. Лицо, которое управляет транспортным средством соответствующего вида и в отношении которого имеются достаточные основания полагать, что это лицо находится в состоянии опьянения, подлежит освидетельствованию на состояние алкогольного опьянения в соответствии с частью 6 настоящей статьи. При отказе от прохождения освидетельствования на состояние алкогольного опьянения либо несогласии указанного лица с результатами освидетельствования, а равно при наличии достаточных оснований полагать, что лицо находится в состоянии опьянения, и отрицательном результате освидетельствования на состояние алкогольного опьянения указанное лицо подлежит направлению на медицинское освидетельствование на состояние опьянения.

2. Отстранение от управления транспортным средством соответствующего вида, освидетельствование на состояние алкогольного опьянения, направление на медицинское освидетельствование на состояние опьянения осуществляются должностными лицами, которым предоставлено право государственного надзора и контроля за безопасностью движения и эксплуатации транспортного средства соответствующего вида, а в отношении водителя транспортного средства Вооруженных Сил Российской Федерации, внутренних войск Министерства внутренних дел Российской Федерации, инженерно-технических, дорожно-строительных воинских формирований при федеральных органах исполнительной власти или спасательных воинских формирований федерального органа исполнительной власти уполномоченного на решение задач в области гражданской обороны – также должностными лицами военной автомобильной инспекции в присутствии двух понятых.

3. Об отстранении от управления транспортным средством, а также о направлении на медицинское освидетельствование на состояние опьянения составляется соответствующий протокол, копия которого вручается лицу, в отношении которого применена данная мера обеспечения производства по делу об административном правонарушении.

4. В протоколе об отстранении от управления транспортным средством соответствующего вида, а также в протоколе о направлении на медицинское освидетельствование на состояние опьянения указываются дата, время, место, основания отстранения от управления или направления на медицинское освидетельствование, должность, фамилия и инициалы лица, составившего протокол, сведения о транспортном средстве и о лице, в отношении которого применена данная мера обеспечения производства по делу об административном правонарушении.

5. Протокол об отстранении от управления транспортным средством, а также протокол о направлении на медицинское освидетельствование на состояние опьянения подписывается должностным лицом, его составившим, и лицом, в отношении которого применена данная мера обеспечения производства по делу об административном правонарушении.

В случае отказа лица, в отношении которого применена данная мера обеспечения производства по делу об административном правонарушении, от подписания соответствующего протокола в нем делается соответствующая запись.

6. Освидетельствование на состояние алкогольного опьянения и оформление его результатов, направление на медицинское освидетельствование на состояние опьянения, медицинское освидетельствование на состояние опьянения и оформление его результатов осуществляются в порядке, установленном Правительством Российской Федерации.

7. Акт освидетельствования на состояние алкогольного опьянения или акт медицинского освидетельствования на состояние опьянения прилагается к соответствующему протоколу. Копии акта освидетельствования на состояние алкогольного опьянения и (или) акта медицинского освидетельствования на состояние опьянения вручаются лицу, в отношении которого они были составлены.

Для отстранения вас от управления ТС в Кодексе предусмотрен закрытый перечень оснований, позволяющих полагать, что вы находитесь в состоянии алкогольного опьянения. Согласно п. 3 Правил освидетельствования, утвержденных Постановлением № 475, достаточными основаниями полагать, что вы находитесь в состоянии алкогольного опьянения, является наличие одного или нескольких признаков: запах алкоголя изо рта, неустойчивость позы, нарушение речи, резкое изменение окраски кожных покровов лица, поведение, не соответствующее обстановке. В том числе основаниями для отстранения от управления ТС служат выявление административных правонарушений, предусмотренных ч. 1 ст. 12.3 КоАП РФ (управление ТС водителем, не имеющим при себе документов на право управления им, регистрационных документов на ТС, а равно документов, подтверждающих право владения, пользования или распоряжения управляемым им ТС в отсутствие его владельца), ч. 2 ст. 12.5 КоАП РФ (управление ТС с заведомо неисправными тормозной системой (за исключением стояночного тормоза), рулевым управлением или сцепным устройством (в составе поезда), ч. 1 ст. 12.7 КоАП РФ (управление ТС водителем, не имеющим права управления ТС (за исключением учебной езды), ч. 2 ст. 12.7 КоАП РФ (управление ТС водителем, лишенным права управления ТС).

Пункт 126 Административного регламента предусматривает еще одно дополнительное основание, по которому вас могут отстранить от управления ТС. Но это основание никак не связано с нарушением ПДД, а вызвано необходимостью использования вашего ТС для проезда к месту стихийного бедствия, доставления в лечебные учреждения граждан, нуждающихся в срочной медицинской помощи, преследования лиц, совершивших преступления, и доставления их в полицию, а также для транспортировки поврежденных при авариях ТС и проезда к месту происшествия или сбора личного состава полиции по тревоге в случаях, не терпящих отлагательства, с отстранением при необходимости водителей от управления этими ТС.

Освидетельствование на состояние алкогольного опьянения, направление на медицинское освидетельствование, отстранение от управления автомобилем может осуществляться только теми лицам, которые указаны в ч. 2 ст. 27.12 КоАП РФ, и в присутствии двух понятых. Ни в коем случае не может быть понятым сотрудник указанных служб – это прямое нарушение закона. Об отстранении от управления ТС или направлении на медицинское освидетельствование обязательно должен быть составлен протокол, в котором, кроме данных сотрудника и ваших данных, обязательно должно быть указано, что явилось основанием для отстранения от управления ТС или направления на медицинское освидетельствование на состояние опьянения. Должны быть также указаны время, место отстранения или направления на медосвидетельствование. Копию протокола сотрудник ГИБДД обязан выдать водителю.

Часть 6 комментируемой статьи говорит о том, что освидетельствование на состояние алкогольного опьянения и оформление его результатов, направление на медицинское освидетельствование на состояние опьянения, медицинское освидетельствование на состояние опьянения и оформление его результатов осуществляются в порядке, установленном Правительством Российской Федерации. В настоящее время действует Постановление № 475, которым определены Правила освидетельствования.

Если вас подозревают в том, что вы управляете автомобилем в состоянии алкогольного опьянения, то сначала должны отстранить от управления ТС, составив протокол, а уже потом предложить пройти освидетельствование на состояние алкогольного опьянения. Имеют право применять новые технические средства измерения – алкотестеры, обеспечивающие запись результатов исследования на бумажный носитель. Сотрудник ГИБДД перед освидетельствованием должен в обязательном порядке информировать о порядке освидетельствования с применением технического средства измерения, целостности клейма государственного поверителя, наличии свидетельства о поверке или записи о поверке в паспорте на алкотестер. Освидетельствование на состояние алкогольного опьянения в обязательном порядке должно проводиться в присутствии двух понятых. Освидетельствование должно проходить на том месте, где вас остановил сотрудник ГИБДД, либо на ближайшем посту ДПС, либо в ином помещении органов внутренних дел, где имеется алкотестер.

Если прибор зафиксирует наличие алкоголя (с учетом погрешности прибора), то сотрудник ГИБДД составит в отношении вас акт освидетельствования, который должны подписать сотрудник ГИБДД и понятые. Если вы не согласны с результатами освидетельствования, сотрудник ГИБДД обязан внести в акт освидетельствования информацию об этом и направить вас уже на медицинское освидетельствование. Также причинами направления на медицинское освидетельствование могут стать отказ от прохождения освидетельствования, наличие у сотрудника ГИБДД достаточных оснований полагать, что вы, несмотря на отрицательный результат проведенного освидетельствования, все-таки находитесь в состоянии алкогольного опьянения. Медицинское освидетельствование проводится при наличии повода к возбуждению в отношении вас дела об административном правонарушении, предусмотренном ст. 12.24 и ч. 2 ст. 12.30 КоАП РФ (см. комментарий к этим статьям), а также при наличии подозрения в отношении вас в совершении преступления против безопасности дорожного движения и эксплуатации транспорта.

О направлении на медицинское освидетельствование составляется протокол, который подписывается сотрудником ГИБДД, двумя понятыми и вами. Вас должны доставить в медицинское учреждение, имеющее лицензию на проведение таких работ. Акт медицинского освидетельствования подписывается врачом или фельдшером, проводившим его. Врач либо фельдшер должны пройти подготовку по вопросам проведения медицинского освидетельствования на состояние опьянения водителей ТС. Один экземпляр акта медицинского освидетельствования обязательно должен быть выдан вам, другой – должностному лицу, а третий хранится в делах медицинского учреждения. Если медицинское освидетельствование не показало наличия алкогольного опьянения, вас должны доставить к месту нахождения ТС. В этом случае, если вы полагаете, что ваши права нарушил сотрудник ГИБДД, отнесшийся к вам предвзято, можете подать на его действия жалобу вышестоящему должностному лицу с приложением имеющихся у вас документов.

На сегодняшний день минимально допустимая норма алкоголя в крови отменена. В случае если вы принимаете какие-то лекарства, которые могут повлиять на уровень алкоголя в крови, советую иметь при себе справку, подтверждающую это. Теперь водителям придется чаще обращаться к процедуре медосвидетельствования на состояние алкогольного опьянения, чтобы опровергнуть показания алкотестера, которые могут быть ошибочными или заведомо неверными.

Статья 27.13. Задержание транспортного средства, запрещение его эксплуатации

1. При нарушениях правил эксплуатации транспортного средства и управления транспортным средством соответствующего вида, предусмотренных частью 1 статьи 11.8.1, статьи 11.9, частью 1 статьи 12.3, частью 2 статьи 12.5, частями 1 и 2 статьи 12.7, частями 1 и 3 статьи 12.8, частью 4 статьи 12.19, частями 1 и 2 статьи 12.21.1, частью 1 статьи 12.21.2, статьей 12.26 настоящего Кодекса, применяется задержание транспортного средства, включающее его перемещение при помощи другого транспортного средства и помещение в специально отведенное охраняемое место (на специализированную стоянку), а также хранение на специализированной стоянке до устранения причины задержания. При невозможности по техническим характеристикам транспортного средства его перемещения и помещения на специализированную стоянку в случаях совершения административных правонарушений, предусмотренных частью 1 статьи 11.8.1, частями 1 и 2 статьи 12.21.1, частью 1 статьи 12.21.2 настоящего Кодекса, задержание осуществляется путем прекращения движения при помощи блокирующих устройств. В случае, если создаются препятствия для движения других транспортных средств или пешеходов, а подлежащее задержанию транспортное средство по его техническим характеристикам не может быть помещено на специализированную стоянку, оно может быть перемещено, в том числе путем управления задержанным транспортным средством его водителем либо лицом, указанным в части 3 настоящей статьи, в близлежащее место, где не будет создавать препятствия для движения других транспортных средств или пешеходов, с последующей блокировкой. Плата за перемещение транспортного средства, за первые сутки его хранения на специализированной стоянке и за блокировку не взимается.

2. При нарушениях правил эксплуатации транспортного средства и управления транспортным средством, предусмотренных статьями 8.23, 9.3, частью 2 статьи 12.1, статьей 12.4, частями 2, 3, 4–6 статьи 12.5, частью 2 статьи 12.37 настоящего Кодекса, запрещается эксплуатация транспортного средства, при этом государственные регистрационные знаки подлежат снятию до устранения причины запрещения эксплуатации транспортного средства.

2.1. Разрешается движение транспортного средства, за исключением случаев, предусмотренных статьей 9.3 и частью 2 статьи 12.5 настоящего Кодекса, к месту устранения причины запрещения эксплуатации транспортного средства, но не более чем в течение суток с момента запрещения эксплуатации транспортного средства.

3. Задержание транспортного средства соответствующего вида, запрещение его эксплуатации осуществляются должностными лицами, уполномоченными составлять протоколы о соответствующих административных правонарушениях, а в отношении транспортного средства Вооруженных Сил Российской Федерации, внутренних войск Министерства внутренних дел Российской Федерации, инженерно-технических, дорожно-строительных воинских формирований при федеральных органах исполнительной власти или спасательных воинских формирований федерального органа исполнительной власти, уполномоченного на решение задач в области гражданской обороны, – также должностными лицами военной автомобильной инспекции.

4. О задержании транспортного средства соответствующего вида, запрещении его эксплуатации делается запись в протоколе об административном правонарушении или составляется отдельный протокол. Копия протокола о задержании транспортного средства соответствующего вида, запрещении его эксплуатации вручается лицу, в отношении которого применена данная мера обеспечения производства по делу об административном правонарушении. Протокол о задержании транспортного средства, создавшего препятствия для движения других транспортных средств, в отсутствие водителя составляется в присутствии двух понятых.

5. Задержание транспортного средства соответствующего вида, возврат транспортного средства, оплата расходов за хранение, а также запрещение эксплуатации транспортного средства осуществляются в порядке, установленном Правительством Российской Федерации.

Процедура задержания ТС регламентирована Правилами задержания ТС, помещения его на стоянку, хранения, а также запрещения эксплуатации, утвержденными постановлением Правительства РФ от 18.12.2003 № 59.

Согласно этим Правилам «задержание транспортного средства представляет собой временное принудительное прекращение использования транспортного средства, включающее (в случае невозможности устранения причины задержания на месте выявления административного правонарушения) помещение его на специализированную стоянку – специально отведенное охраняемое место хранения задержанных транспортных средств ». Задержание – обеспечительная мера. После устранения причины задержания автомобиль подлежит выдаче владельцу либо доверенному лицу.

Задержать ваш автомобиль возможно только в строго определенных в законе случаях.

1. Отсутствие прав и документов на ТС, предусмотренных ПДД, отсутствие доверенности, если вы не являетесь собственником ТС (ч. 1 ст. 12.3 КоАП РФ). Отсутствие талона техосмотра и страхового полиса ОСАГО основанием для задержания автомобиля не является, ответственность за это предусмотрена ч. 2 ст. 12.3 КоАП РФ в виде предупреждения либо штрафа в размере 100 рублей. Поскольку эта ч. 2 не перечислена в ст. 27.13 КоАП РФ, то задержание автомашины из-за отсутствия страхового полиса ОСАГО или талона технического осмотра – злоупотребление должностными полномочиями со стороны сотрудников ГИБДД.

2. Заведомая неисправность тормозной системы, рулевого управления и сцепного устройства в составе автопоезда (ч. 2 ст. 12.5 КоАП РФ).

3. Водитель не имеет права управлять данной категорией ТС, кроме учебной езды, а также если водитель был лишен права управления (ч. 1 и 2 ст. 12.7 КоАП РФ), в том числе если просрочены водительские права.

4. Водитель управляет авто в состоянии опьянения (ст. 12.8 КоАП РФ).

5. За невыполнение законного требования сотрудника ГИБДД о прохождении медицинского освидетельствования на состояние опьянения (ст. 12.26 КоАП РФ).

6. За нарушение правил остановки или стоянки на проезжей части, повлекшее создание препятствия для движения других машин, равно как и за остановку или стоянку в тоннеле (ч. 4 ст. 12.19 КоАП РФ).

7. Перевозка крупногабаритных и тяжеловесных грузов без разрешения, с отклонением от маршрута, указанного в разрешении, а также перевозка крупногабаритных грузов с превышением указанных в разрешении габаритов более чем на 10 см (ч. 1 и 2 ст. 12.21.1 КоАП РФ).

8. Нарушение правил перевозки опасных грузов (ч. 1 ст. 12.21.2 КоАП РФ).

В последних двух случаях речь идет о грузовых автомобилях с большими габаритами, поэтому Кодекс допускает, что задержание может быть осуществлено с помощью блокирующих устройств без перемещения автомобиля на специализированную стоянку.

Часть 2 ст. 27.13 КоАП РФ говорит о запрещении эксплуатации ТС со снятием государственных номерных знаков. Основаниями для такой меры являются другие административные правонарушения, за исключением ч. 2 ст. 12.5 КоАП РФ (заведомая неисправность тормозной системы, рулевого управления и сцепного устройства в составе автопоезда). Основаниями для запрещения эксплуатации со снятием номеров признаны следующие.

1. Эксплуатация ТС с превышением содержания загрязняющих веществ в выбросах либо уровня шума (ст. 8.23 КоАП РФ).

2. Управление ТС, которое не прошло техосмотр (ст. 12.1 КоАП РФ). В эту же категорию попадают не только те, кто не смог пройти техосмотр, но и те, кто по каким-либо причинам забыл вовремя это сделать.

3. Нарушение правил установки на автомобиле устройств для подачи специальных световых и звуковых сигналов, а также незаконное нанесение цветографических схем автомобилей оперативных служб (ст. 12.4 КоАП РФ).

4. Управление автомобилем, на котором имеются незаконно нанесенные обозначения оперативных служб, установлены ненадлежащие специальные звуковые и световые приборы, а также использование в процессе движения устройств для подачи специальных световых и звуковых сигналов, установленных без разрешения (ч. 3–6 ст. 12.5 КоАП РФ).

5. Несоблюдение требований ОСАГО владельцем машины, а также управление таким ТС, если вы заведомо знали об отсутствии страховки (ч. 2 ст. 12.37 КоАП РФ).

О порядке снятия и возврата госномеров смотрите комментарий к ст. 12.5 КоАП рФ. Часть 2.1 ст. 27.13 КоАП РФ предусматривает возможность ехать на место устранения причины запрещения эксплуатации ТС, но не более чем в течение суток с момента вынесения запрета на эксплуатацию ТС. То есть если вас остановили без техосмотра в другом населенном пункте, то вам предоставят возможность доехать до того населенного пункта, где состоит на учете автомобиль, чтобы пройти техосмотр, но не более чем в течение суток. Данное правило не действует, если вам вменяют в вину нарушение ч. 2 ст. 12.5 КоАП РФ.

О задержании ТС составляется протокол либо делается запись в уже составленном протоколе об административном правонарушении. Если ваш автомобиль помещают на штрафстоянку, необходимо проконтролировать, чтобы была составлена опись имеющихся в автомобиле вещей. Один экземпляр протокола и описи должен быть обязательно вручен вам, еще один вручается лицу, ответственному за хранение автомобилей на штрафстоянке.

Первые сутки на штрафстоянке должны быть бесплатными, как и перемещение туда вашего автомобиля. Время помещения автомобиля на такую стоянку должно быть обязательно указано в протоколе о задержании ТС. В дальнейшем плата за штрафстоянку взимается за каждый полный час нахождения там авто (по истечении первых суток).

Если вы можете устранить причину задержания ТС или запрещения его эксплуатации на месте, обязательно заявите об этом сотруднику ГИБДД. В случае если он остается непреклонен и намеревается поместить автомобиль на штрафстоянку, напишите ходатайство в раздел объяснений протокола, чтобы при дальнейших разбирательствах в суде было ясно, что вы имели намерение и возможность на месте устранить причины, повлекшие задержание ТС и запрещение его эксплуатации.

Выдача автомобиля со штрафстоянки производится только по письменному разрешению уполномоченного на это должностного лица с обязательной записью в протоколе о задержании ТС либо в протоколе об административном правонарушении. Выдача автомобиля со штрафстоянки не должна увязываться с оплатой штрафа, ведь по закону вы обязаны заплатить штраф в течение 30 дней.

С 1 июля 2012 года законодатели решили основательно переписать данную статью.

1. При нарушениях правил эксплуатации транспортного средства и управления транспортным средством соответствующего вида, предусмотренных частью 1 статьи 11.8.1, статьей 11.9, частью 1 статьи 12.3, частью 2 статьи 12.5, частями 1 и 2 статьи 12.7, частями 1, 3 и 4 статьи 12.8, частями 4 и 5 статьи 12.16 , частями 3–4, 6 статьи 12.19, частями 1–3 статьи 12.21.1, частью 1 статьи 12.21.2, статьей 12.26, частью 3 статьи 12.27 настоящего Кодекса, применяются задержание транспортного средства, то есть исключение транспортного средства из процесса перевозки людей и грузов путем перемещения его при помощи другого транспортного средства и помещения в ближайшее специально отведенное охраняемое место (на специализированную стоянку), и хранение на специализированной стоянке до устранения причины задержания. При невозможности по техническим характеристикам транспортного средства его перемещения и помещения на специализированную стоянку в случае совершения административного правонарушения, предусмотренного частью 1, 2 или 3 статьи 12.21.1 или частью 1 статьи 12.21.2 настоящего Кодекса, задержание осуществляется путем прекращения движения при помощи блокирующих устройств. В случае, если транспортное средство, в отношении которого принято решение о задержании , будет создавать препятствия для движения других транспортных средств или пешеходов, оно до начала задержания может быть перемещено путем управления транспортным средством его водителем либо лицами, указанными в части 3 настоящей статьи, в ближайшее место, где данное транспортное средство таких препятствий создавать не будет.

2. При нарушениях правил эксплуатации транспортного средства и управления транспортным средством, предусмотренных статьями 8.23, 9.3, частью 2 статьи 12.1, статьей 12.4, частями 2–6 статьи 12.5, частью 2 статьи 12.37 настоящего Кодекса, запрещается эксплуатация транспортного средства, при этом государственные регистрационные знаки подлежат снятию до устранения причины запрещения эксплуатации транспортного средства. Разрешается движение транспортного средства, за исключением случаев, предусмотренных статьей 9.3 и частью 2 статьи 12.5 настоящего Кодекса, к месту устранения причины запрещения эксплуатации транспортного средства, но не более чем в течение суток с момента запрещения эксплуатации транспортного средства.

3.  Решение о задержании транспортного средства соответствующего вида, запрещении его эксплуатации или о прекращении указанных задержания и запрещения принимается должностными лицами, уполномоченными составлять протоколы о соответствующих административных правонарушениях, а в отношении транспортного средства Вооруженных Сил Российской Федерации, внутренних войск Министерства внутренних дел Российской Федерации, инженерно-технических, дорожно-строительных воинских формирований при федеральных органах исполнительной власти или спасательных воинских формирований федерального органа исполнительной власти, уполномоченного на решение задач в области гражданской обороны, также должностными лицами военной автомобильной инспекции. Указанными должностными лицами составляется протокол о применении соответствующей меры обеспечения производства по делу об административном правонарушении.

4. В протоколе о задержании транспортного средства или в протоколе о запрещении эксплуатации транспортного средства указываются дата, время, место, основания принятия решения о задержании транспортного средства или запрещении его эксплуатации, должность, фамилия и инициалы лица, составившего протокол, сведения о транспортном средстве и о лице, в отношении которого применена соответствующая мера обеспечения производства по делу об административном правонарушении. В протоколе о задержании транспортного средства указываются наименование органа (учреждения, организации), должность, фамилия, имя и отчество лица, которое будет исполнять решение о задержании транспортного средства.

5. Протокол о задержании транспортного средства или протокол о запрещении эксплуатации транспортного средства подписывается должностным лицом, их составившим, и лицом, в отношении которого применена соответствующая мера обеспечения производства по делу об административном правонарушении.

6. В случае отказа лица, в отношении которого применена мера обеспечения производства по делу об административном правонарушении, от подписания протокола в нем делается соответствующая запись.

7. Копия протокола о задержании транспортного средства соответствующего вида или протокола о запрещении эксплуатации транспортного средства вручается лицу, в отношении которого применена соответствующая мера обеспечения производства по делу об административном правонарушении.

8. Протокол о задержании транспортного средства в отсутствие водителя составляется в присутствии двух понятых.

9. Перемещение транспортных средств Вооруженных Сил Российской Федерации, внутренних войск Министерства внутренних дел Российской Федерации, инженерно-технических, дорожно-строительных воинских формирований при федеральных органах исполнительной власти или спасательных воинских формирований федерального органа исполнительной власти, уполномоченного на решение задач в области гражданской обороны, на специализированную стоянку, их хранение, оплата расходов на перемещение и хранение, возврат транспортных средств и обеспечение запрещения эксплуатации транспортного средства осуществляются в порядке, установленном Правительством Российской Федерации.

10. Перемещение транспортных средств на специализированную стоянку, за исключением транспортных средств, указанных в части 9 настоящей статьи, их хранение, оплата расходов на перемещение и хранение, возврат транспортных средств осуществляются в порядке, устанавливаемом законами субъектов Российской Федерации.

11. Расходы на перемещение и хранение задержанного транспортного средства, за исключением транспортных средств, указанных в части 9 настоящей статьи, возмещаются лицом, совершившим административное правонарушение, повлекшее применение задержания транспортного средства.

12. В случае прекращения производства по делу об административном правонарушении по основаниям, предусмотренным пунктом 1, пунктом 2 (за исключением случая недостижения физическим лицом на момент совершения противоправных действий (бездействия) возраста, предусмотренного настоящим Кодексом для привлечения к административной ответственности), пунктами 3, 7 части 1 статьи 24.5 настоящего Кодекса, расходы на перемещение и хранение транспортного средства возмещаются в порядке, установленном законодательством Российской Федерации, а транспортное средство незамедлительно возвращается его владельцу или лицу, обладающему правом пользования или распоряжения данным транспортным средством.

В статье появилось дополнительно еще семь частей, которые детально расписывают действия водителей и сотрудников ГИБДД в случае запрещения эксплуатации транспортного средства и направления его на штрафстоянку. В частности, расходы на перемещение, хранение и возврат автомобиля теперь регулируются законами субъектов Российской Федерации. Исключение составляют транспортные средства Вооруженных сил, внутренних войск МВД, инженерно-технических и дорожно-строительных воинских формирований федеральных органов исполнительной власти, а также спасательных воинских формирований. Расходы на перемещение, хранение и возврат таких транспортных средств регулируются только Постановлением Правительства РФ. При этом в ч. 1 ст. 27.13 КоАП РФ было прописано, что хранение ТС на специализированной штрафстоянке в течение суток бесплатно, а теперь это оставлено на усмотрение органов исполнительной власти субъектов РФ. Бесплатное перемещение, хранение и возврат транспортных средств предоставляется водителям исключительно только на основании закона субъекта РФ, в котором данное ТС было задержано. Если в законе эта возможность не прописывается, водителю придется оплатить все расходы, понесенные эвакуационной службой и отделением ГИБДД, которые осуществляли перемещение и хранение транспортного средства, включая последующий его возврат владельцу. Частью 12 данной статьи отдельно прописываются условия по возврату автомобиля водителю в случае устранения причин административного правонарушения.

Возбуждение дела об административном правонарушении

Статья 28.1. Возбуждение дела об административном правонарушении

1. Поводами к возбуждению дела об административном правонарушении являются:

1) непосредственное обнаружение должностными лицами, уполномоченными составлять протоколы об административных правонарушениях, достаточных данных, указывающих на наличие события административного правонарушения;

2) поступившие из правоохранительных органов, а также из других государственных органов, органов местного самоуправления, от общественных объединений материалы, содержащие данные, указывающие на наличие события административного правонарушения;

3) сообщения и заявления физических и юридических лиц, а также сообщения в средствах массовой информации, содержащие данные, указывающие на наличие события административного правонарушения (за исключением административных правонарушений, предусмотренных частью 2 статьи 5.27, статьями 14.12, 14.13 настоящего Кодекса);

4) фиксация административного правонарушения в области дорожного движения работающими в автоматическом режиме специальными техническими средствами, имеющими функции фото– и киносъемки, видеозаписи, или средствами фото– и киносъемки, видеозаписи;

5) подтверждение содержащихся в сообщении или заявлении собственника (владельца) транспортного средства данных о том, что в случаях, предусмотренных пунктом 4 настоящей части, транспортное средство находилось во владении или в пользовании другого лица.

1.1. Поводами к возбуждению дел об административных правонарушениях, предусмотренных статьями 14.12, 14.13, 14.23 настоящего Кодекса, являются поводы, указанные в пунктах 1 и 2 части 1 настоящей статьи, а также сообщения и заявления собственника имущества унитарного предприятия, органов управления юридического лица, арбитражного управляющего, а при рассмотрении дела о банкротстве – собрания (комитета) кредиторов.

1.2. Поводом к возбуждению дел об административных правонарушениях, предусмотренных статьями 14.9, 14.31, 14.31.1 -14.33 настоящего Кодекса, является вступление в силу решения комиссии антимонопольного органа, которым установлен факт нарушения антимонопольного законодательства Российской Федерации.

2. Указанные в частях 1 и 1.1 настоящей статьи материалы, сообщения, заявления подлежат рассмотрению должностными лицами, уполномоченными составлять протоколы об административных правонарушениях.

3. Дело об административном правонарушении может быть возбуждено должностным лицом, уполномоченным составлять протоколы об административных правонарушениях, только при наличии хотя бы одного из поводов, предусмотренных частями 1 и 1.1 настоящей статьи, и достаточных данных, указывающих на наличие события административного правонарушения.

4. Дело об административном правонарушении считается возбужденным с момента:

1) составления протокола осмотра места совершения административного правонарушения;

2) составления первого протокола о применении мер обеспечения производства по делу об административном правонарушении, предусмотренных статьей 27.1 настоящего Кодекса;

3) составления протокола об административном правонарушении или вынесения прокурором постановления о возбуждении дела об административном правонарушении;

4) вынесения определения о возбуждении дела об административном правонарушении при необходимости проведения административного расследования, предусмотренного статьей 28.7 настоящего Кодекса;

5) пункт утратилсилу с 24 ноября 2009 года – Федеральный закон от 9 ноября 2009 года № 249-ФЗ – см. предыдущую редакцию;

6) вынесения постановления по делу об административном правонарушении в случае, предусмотренном частью 1 или 3 статьи 28.6 настоящего Кодекса.

5. В случае отказа в возбуждении дела об административном правонарушении при наличии материалов, сообщений, заявлений, указанных в пунктах 2 и 3 части 1 настоящей статьи, должностным лицом, рассмотревшим указанные материалы, сообщения, заявления, выносится мотивированное определение об отказе в возбуждении дела об административном правонарушении.

Из перечисленных поводов к возбуждению дела об административном правонарушении в данной статье к рассматриваемому нами аспекту нарушений относятся поводы, указанные в пп. 1, 4 и 5 ч. 1.

Рассмотрим их подробнее. Пункт 1 – это непосредственное обнаружение должностным лицом, которое может составить протокол об административном правонарушении, достаточных данных, которые свидетельствуют о том, что правонарушение совершено. Например, вас остановил сотрудник ГИБДД за проезд перекрестка на красный свет – это уже наличие достаточных данных, что вы совершили правонарушение. Ну и все другие нарушения ПДД, которые обнаруживаются на месте и которые, по мнению сотрудника ГИБДД, вы совершили.

Пункты 4 и 5 взаимосвязаны. В п. 4 речь идет о фиксации правонарушения средствами фото– и киносъемки и видеозаписи, работающими в автоматическом режиме. В этом случае дело об административном правонарушении также возбуждается автоматически в отношении владельца ТС. Но если подтвердится тот факт, что во время фиксации правонарушения ваш автомобиль был во владении и пользовании другого лица, то в отношении этого лица и возбуждается дело об административном правонарушении (п. 5 ст. 28.1 КоАП РФ).

Должностное лицо имеет право возбудить дело об административном правонарушении только при наличии одного из поводов и достаточных данных, говорящих о том, что правонарушение было совершено.

Есть определенные моменты, с наступлением которых дело об административном правонарушении считается возбужденным. Часть 4 настоящей статьи содержит исчерпывающий перечень таких событий.

1. Составление протокола осмотра места совершения административного правонарушения. Это предусматривается только в случае совершения правонарушения по ст. 12.24 КоАП РФ (нарушение ПДД или правил эксплуатации транспорта, повлекшее причинение легкого или средней тяжести вреда здоровью потерпевшего) и ч. 2 ст. 12.30 КоАП РФ (нарушение ПДД пешеходом, пассажиром ТС, другим участником дорожного движения, кроме водителя, повлекшее причинение легкого или средней тяжести вреда здоровью потерпевшего).

2. Составление первого протокола о применении обеспечительных мер. Данные меры перечислены в ст. 27.1 КоАП РФ. Это освидетельствование на состояние алкогольного опьянения, медицинское освидетельствование на состояние опьянения, отстранение от управления ТС, задержание ТС, запрещение его эксплуатации, досмотр ТС, досмотр личных вещей, находящихся при вас, личный досмотр, арест ТС, привод, доставление и административное задержание.

3. Если в отношении вас составлен протокол об административном правонарушении. Подробнее об этом будет рассказано в комментарии к ст. 28.2 КоАП РФ.

4. С момента вынесения определения о возбуждении дела об административном правонарушении с проведением административного расследования. Административное расследование необходимо для более точного установления всех обстоятельств дела. Например, при ДТП, где есть пострадавшие.

5. Как только вам вынесли предупреждение или наложили штраф путем выписки постановления-квитанции, то есть когда событие нарушения ПДД вами не оспаривается и вы готовы оплатить штраф на месте.

6. С момента вынесения постановления по делу об административном правонарушении без участия привлекаемого к ответственности лица в порядке ч. 3 ст. 28.6 КоАП РФ. Речь идет о случаях фиксации нарушения автоматическими видеокамерами и прочими автоматическими устройствами, ведущими кино– и фотосъемку.

С 1 января 2012 года в п. 4 ч. 1 данной статьи вносятся также административные правонарушения в области благоустройства территории: «фиксация административного правонарушения в области дорожного движения или административного правонарушения в области благоустройства территории, предусмотренного законом субъекта Российской Федерации, совершенного с использованием транспортного средства, работающими в автоматическом режиме специальными техническими средствами, имеющими функции фото– и киносъемки, видеозаписи, или средствами фото– и киносъемки, видео – записи ». Статья 28.2. Протокол об административном правонарушении

1. О совершении административного правонарушения составляется протокол, за исключением случаев, предусмотренных статьей 28.4, частями 1, 1.1 и 3 статьи 28.6 настоящего Кодекса.

2. В протоколе об административном правонарушении указываются дата и место его составления, должность, фамилия и инициалы лица, составившего протокол, сведения о лице, в отношении которого возбуждено дело об административном правонарушении, фамилии, имена, отчества, адреса места жительства свидетелей и потерпевших, если имеются свидетели и потерпевшие, место, время совершения и событие административного правонарушения, статья настоящего Кодекса или закона субъекта Российской Федерации, предусматривающая административную ответственность за данное административное правонарушение, объяснение физического лица или законного представителя юридического лица, в отношении которых возбуждено дело, иные сведения, необходимые для разрешения дела.

3. При составлении протокола об административном правонарушении физическому лицу или законному представителю юридического лица, в отношении которых возбуждено дело об административном правонарушении, а также иным участникам производства по делу разъясняются их права и обязанности, предусмотренные настоящим Кодексом, о чем делается запись в протоколе.

4. Физическому лицу или законному представителю юридического лица, в отношении которых возбуждено дело об административном правонарушении, должна быть предоставлена возможность ознакомления с протоколом об административном правонарушении. Указанные лица вправе представить объяснения и замечания по содержанию протокола, которые прилагаются к протоколу.

4.1. В случае неявки физического лица, или законного представителя физического лица, или законного представителя юридического лица, в отношении которых ведется производство по делу об административном правонарушении, если они извещены в установленном порядке, протокол об административном правонарушении составляется в их отсутствие. Копия протокола об административном правонарушении направляется лицу, в отношении которого он составлен, в течение трех дней со дня составления указанного протокола.

5. Протокол об административном правонарушении подписывается должностным лицом, его составившим, физическим лицом или законным представителем юридического лица, в отношении которых возбуждено дело об административном правонарушении. В случае отказа указанных лиц от подписания протокола, а также в случае, предусмотренном частью 4.1 настоящей статьи, в нем делается соответствующая запись.

6. Физическому лицу или законному представителю юридического лица, в отношении которых возбуждено дело об административном правонарушении, а также потерпевшему вручается под расписку копия протокола об административном правонарушении.

Порядок составления протокола об административном правонарушении установлен настоящей статьей, а также дополнен положениями Административного регламента. Протокол об административном правонарушении составляется немедленно после его выявления, но может быть составлен и в течение двух суток со дня выявления правонарушения, если требуется дополнительное выяснение обстоятельств дела либо данных о лице, в отношении которого возбуждается дело об административном правонарушении. Если вынесено определение о возбуждении дела об административном правонарушении, то протокол составляется по окончании проведения административного расследования.

Форма протокола утверждена приказом Министерства внутренних дел, является приложением к Административному регламенту. В Кодексе содержится перечень сведений, которые должны быть включены в протокол. Обязательно должны быть указаны не только пункт ПДД, который вы нарушили, но и статья Кодекса, по которой подлежит наказание за данное правонарушение. В протокол заносятся также фамилии, имена, отчества, адреса мест жительства свидетелей и потерпевших, должны быть указаны должность лица, составившего протокол, его фамилия и инициалы.

В случае применения технических средств, относящихся к измерительным приборам, их показания отражаются в протоколе об административном правонарушении. При этом указываются название технического средства и его номер.

Письменные ходатайства лиц, участвующих в производстве по делу об административном правонарушении, приобщаются к делу и подлежат немедленному рассмотрению. Решение об отказе в удовлетворении ходатайства выносится сотрудником в виде определения. При ходатайстве лица, в отношении которого ведется производство по делу об административном правонарушении, о рассмотрении дела по месту его жительства, данное ходатайство может быть отражено в протоколе об административном правонарушении.

Сотрудник, который составляет протокол, обязан разъяснить права и обязанности, предусмотренные Кодексом. Только после этого вы можете поставить свою подпись в соответствующей графе протокола.

Вам обязательно должны предоставить возможность ознакомиться с протоколом. Вы имеете право высказать замечания к протоколу и добавить объяснения, которые могут быть приложены на отдельном листе. Следует сказать, что, если вы не считаете себя виновным и планируете в дальнейшем обжаловать незаконное привлечение к административной ответственности, не указывайте на ошибки в оформлении протокола: быть может, вам удастся его обжаловать как составленный со значительными нарушениями, и он будет отменен.

Копия составленного протокола выдается потерпевшему и лицу, в отношении которого он составлен. О том, что получили копию, вы расписываетесь в соответствующей графе. Отказ в выдаче копии протокола является незаконным.

Если протокол составлен с нарушениями, он может быть признан ненадлежащим доказательством, и вы можете заявить об этом ходатайство.

Статья 28.3. Должностные лица, уполномоченные составлять протоколы об административных правонарушениях

1. Протоколы об административных правонарушениях, предусмотренных настоящим Кодексом, составляются должностными лицами органов, уполномоченных рассматривать дела об административных правонарушениях в соответствии с главой 23 настоящего Кодекса, в пределах компетенции соответствующего органа.

2. Помимо случаев, предусмотренных частью 1 настоящей статьи, протоколы об административных правонарушениях вправе составлять должностные лица федеральных органов исполнительной власти, их структурных подразделений и территориальных органов, должностные лица иных государственных органов в соответствии с задачами и функциями, возложенными на них федеральными законами либо нормативными правовыми актами Президента Российской Федерации или Правительства Российской Федерации, должностные лица органов исполнительной власти субъектов Российской Федерации в случае передачи им полномочий Российской Федерации на осуществление государственного контроля и надзора, указанные в настоящей статье:

1) должностные лица органов внутренних дел (полиции) – об административных правонарушениях, предусмотренных частью 4 статьи 12.2, частью 2 статьи 12.3, частями 1 и 2 статьи 12.4, частями 3, 4–6 статьи 12.5, частью 2 статьи 12.7, статьей 12.8, частью 3 статьи 12.10, частью 4 статьи 12.15, статьей 12.26, частями 2 и 3 статьи 12.27 […].

Статья 28.3 КоАП РФ говорит о том, каким именно должностным лицам разрешено составлять протоколы об административном правонарушении в области дорожного движения. Причем ч. 1 комментируемой статьи первоначально отсылает нас к гл. 23 КоАП РФ, где в ст. 23.3 перечислены должностные лица, уполномоченные рассматривать дела об административных правонарушениях в области нарушения дорожного движения, которые также могут составлять протоколы об административном правонарушении. А в ст. 23.1 КоАП РФ приводится перечень нарушений ПДД, рассмотрение которых отнесено к компетенции судей.

В ч. 2 комментируемой статьи законодатель дополняет перечень должностных лиц, уполномоченных составлять протоколы об административном правонарушении в области дорожного движения по причине того, что рассмотрение дела отнесено к компетенции суда или должностного лица, которое непосредственно не осуществляет контроль за дорожным движением.

Исчерпывающий перечень должностных лиц установлен приказом МВД РФ от 02.06.2005 № 444 «О полномочиях должностных лиц МВД России по составлению протоколов по делам об административных правонарушениях и административному задержанию» (с изм. и доп.). Это следующие должностные лица: командир (заместитель командира) взвода, начальник контрольного поста полиции, начальник смены контрольного поста полиции, инспектор строевого подразделения Госавтоинспекции, старший государственный инспектор, государственный инспектор, инспектор подразделений технического надзора, регистрационной и экзаменационной деятельности Госавтоиспекции, старший государственный инспектор дорожного надзора, государственный инспектор дорожного надзора.

Согласно вышеупомянутому приказу протоколы об административном правонарушении в области дорожного движения также могут составлять следующие должностные лица: командир взвода (отделения) ППС, заместитель командира взвода ППС, командир (заместители командира) отряда полиции особого назначения, сотрудник полиции, командир катера, командир взвода (отделения) охраны и конвоирования подозреваемых и обвиняемых, помощники командира взвода, участкового уполномоченного полиции, старшина, водитель-сотрудник, а также иные должностные лица, являющиеся сотрудниками органов внутренних дел, при осуществлении в установленном порядке обязанностей по охране общественного порядка и обеспечению общественной безопасности по ст. 12.1, 12.2, 12.3 (за исключением случаев управления ТС водителем, не имеющим при себе лицензионной карточки), 12.6, 12.7, 12.10–12.20, 12.25, 12.29 КоАП РФ.

С 1 января 2012 года п. 1 ч. 2 данной статьи будет сформулирован по-другому (в содержании указываются только административные правонарушения в области дорожного движения, указанные в гл. 12 КоАП РФ): «1) должностные лица органов внутренних дел (полиции) – об административных правонарушениях, предусмотренных частью 4 статьи 12.2, частями 2 и 2.1 статьи 12.3, частями 1, 2 и частью 3 (в случаях незаконного нанесения цветографической схемы легкового такси) статьи 12.4, частями 3, 4–7 статьи 12.5, частью 2 статьи 12.7, статьей 12.8, частью 3 статьи 12.10, частью 4 статьи 12.15, статьей 12.26, частями 2 и 3 статьи 12.27».

Статья 28.5. Сроки составления протокола об административном правонарушении

1. Протокол об административном правонарушении составляется немедленно после выявления совершения административного правонарушения.

2. В случае если требуется дополнительное выяснение обстоятельств дела либо данных о физическом лице или сведений об юридическом лице, в отношении которых возбуждается дело об административном правонарушении, протокол об административном правонарушении составляется в течение двух суток с момента выявления административного правонарушения.

3. В случае проведения административного расследования протокол об административном правонарушении составляется по окончании расследования в сроки, предусмотренные статьей 28.7 настоящего Кодекса .

Основаниями составления протокола об административном правонарушении являются следующие.

Выявление административного правонарушения, в случае если рассмотрение дела о данном административном правонарушении не находится в компетенции сотрудника. Это может быть дело, относящееся к компетенции судьи, как, например, правонарушение по ст. 12.15 КоАП РФ, либо вышестоящего должностного лица по отношению к этому сотруднику.

• Оспаривание лицом, в отношении которого возбуждено дело, наличия события административного правонарушения и (или) назначенного ему административного наказания. Если вы не согласны с вменяемым вам в вину правонарушением, ни о каком постановлении-квитанции не может быть и речи, сотрудник ГИБДД должен составить протокол об административном правонарушении и копию передать вам, чтобы вы могли его обжаловать.

• Выявление административного правонарушения, совершенного несовершеннолетним, достигшим возраста шестнадцати лет.

• Выявление административного правонарушения, не влекущего предупреждения, совершенного сержантом, старшиной, солдатом, матросом, проходящими военную службу по призыву, либо курсантом военного образовательного учреждения профессионального образования до заключения с ним контракта о прохождении военной службы.

При наличии данных оснований следует учитывать, что протокол об административном правонарушении может быть составлен в течение двух суток с момента выявления административного правонарушения в случае, если требуется дополнительное выяснение обстоятельств дела либо данных о лице, в отношении которого возбуждается дело об административном правонарушении.

В случае когда выносится определение о назначении административного расследования (например, необходимо произвести экспертизу или другие занимающие время мероприятия), протокол составляется только по окончании этого расследования. Срок административного расследования составляет один месяц, но может быть продлен по ходатайству лица, проводящего административное расследование. Общий срок продления административного расследования составляет один месяц, но если дело касается нарушения ПДД, повлекшего причинение легкого или средней тяжести вреда здоровью, может увеличиваться до шести месяцев. Протокол об административном правонарушении может быть составлен только по окончании административного расследования.

Статья 28.6. Назначение административного наказания без составления протокола

1. В случае если при совершении физическим лицом административного правонарушения назначается административное наказание в виде предупреждения или административного штрафа, протокол об административном правонарушении не составляется, а уполномоченным на то должностным лицом на месте совершения административного правонарушения выносится постановление по делу об административном правонарушении о назначении административного наказания в виде предупреждения или административного штрафа в порядке, предусмотренном статьей 29.10 настоящего Кодекса. Копия постановления по делу об административном правонарушении вручается под расписку лицу, в отношении которого оно вынесено, а также потерпевшему по его просьбе.

1.1. В случае совершения административных правонарушений, предусмотренных частями 1 и 3 статьи 17.14 и статьей 17.15 настоящего Кодекса, протокол об административном правонарушении не составляется. Рассмотрение дел об административных правонарушениях, назначение и исполнение административного наказания осуществляются в порядке, предусмотренном настоящим Кодексом, с учетом особенностей, установленных Федеральным законом «Об исполнительном производстве».

2. В случае если лицо, в отношении которого возбуждено дело об административном правонарушении, оспаривает наличие события административного правонарушения и (или) назначенное ему административное наказание, составляется протокол об административном правонарушении.

3. В случае выявления административного правонарушения, предусмотренного главой 12 настоящего Кодекса и зафиксированного с применением работающих в автоматическом режиме специальных технических средств, имеющих функции фото– и киносъемки, видеозаписи, или средств фото – и киносъемки, видеозаписи, протокол об административном правонарушении не составляется, а постановление по делу об административном правонарушении выносится без участия лица, в отношении которого возбуждено дело об административном правонарушении, и оформляется в порядке, предусмотренном статьей 29.10 настоящего Кодекса. Копии постановления по делу об административном правонарушении и материалов, полученных с применением работающих в автоматическом режиме специальных технических средств, имеющих функции фото– и киносъемки, видеозаписи, или средств фото – и киносъемки, видеозаписи, направляются лицу, в отношении которого возбуждено дело об административном правонарушении, по почте заказным почтовым отправлением в течение трех дней со дня вынесения указанного постановления.

Если за административное правонарушение положено наказание в виде предупреждения либо штрафа, то протокол может не составляться, а сразу выносится постановление.

В том случае, если вы оспариваете правильность назначенного наказания либо вообще считаете себя невиновным в совершении правонарушения, сотрудник ГИБДД не должен вообще выносить постановление, а ограничиться составлением протокола об административном правонарушении. И вы получаете возможность обжаловать данный протокол в установленном порядке: либо у вышестоящего должностного лица, либо в суде.

Без составления протокола обходится применение санкций по ч. 6 ст. 28 КоАП РФ, если правонарушение зафиксировано с применением работающих в автоматическом режиме специальных технических средств, имеющих функции фото– и киносъемки, видеозаписи, или средств фото– и киносъемки, видеозаписи.

С 1 января 2012 года в ч. 3 ст. 28.6 КоАП РФ добавляются также административные правонарушения в области благоустройства территории: «В случае выявления административного правонарушения, предусмотренного главой 12 настоящего Кодекса, или административного правонарушения в области благоустройства территории, предусмотренного законом субъекта Российской Федерации, совершенного с использованием транспортного средства , зафиксированных с применением работающих в автоматическом режиме специальных технических средств, имеющих функции фото– и киносъемки, видеозаписи, или средств фото– и киносъемки, видеозаписи, протокол об административном правонарушении не составляется, а постановление по делу об административном правонарушении выносится без участия лица, в отношении которого возбуждено дело об административном правонарушении, и оформляется в порядке, предусмотренном статьей 29.10 настоящего Кодекса. Копии постановления по делу об административном правонарушении и материалов, полученных с применением работающих в автоматическом режиме специальных технических средств, имеющих функции фото– и киносъемки, видеозаписи, или средств фото-и киносъемки, видеозаписи , направляются лицу, в отношении которого возбуждено дело об административном правонарушении, по почте заказным почтовым отправлением в течение трех дней со дня вынесения указанного постановления».

Статья 28.8. Направление протокола (постановления прокурора) об административном правонарушении для рассмотрения дела об административном правонарушении

1. Протокол (постановление прокурора) об административном правонарушении направляется судье, в орган, должностному лицу, уполномоченным рассматривать дело об административном правонарушении, в течение трех суток с момента составления протокола (вынесения постановления) об административном правонарушении.

2. Протокол (постановление прокурора) об административном правонарушении, совершение которого влечет административный арест либо административное выдворение, передается на рассмотрение судье немедленно после его составления (вынесения).

3. В случае если протокол об административном правонарушении составлен неправомочным лицом, а также в иных случаях, предусмотренных пунктом 4 части 1 статьи 29.4 настоящего Кодекса, недостатки протокола и других материалов дела об административном правонарушении устраняются в срок не более трех суток со дня их поступления (получения) от судьи, органа, должностного лица, рассматривающих дело об административном правонарушении. Материалы дела об административном правонарушении с внесенными в них изменениями и дополнениями возвращаются указанным судье, органу, должностному лицу в течение суток со дня устранения соответствующих недостатков.

4. В случае если применена мера обеспечения производства по делу об административном правонарушении в виде временного запрета деятельности, протокол об административном правонарушении, за совершение которого может быть назначено административное наказание в виде административного приостановления деятельности, а также протокол о временном запрете деятельности передается на рассмотрение судье, в орган, должностному лицу, уполномоченным рассматривать дело об административном правонарушении, немедленно после их составления.

Составленный протокол об административном правонарушении и материалы дела направляются судье, должностному лицу в течение трех суток с момента составления протокола. Началом отсчета данного срока является тот день, когда был составлен протокол. Если последний день срока пришелся на нерабочий день, то днем окончания срока считается следующий за ним рабочий день. В случае когда речь идет о назначении наказания в виде административного ареста или выдворения, протокол передается судье немедленно. Если правонарушение было совершено не в рабочее время судьи, то вас в этом случае могут подвергнуть административному задержанию.

В случае когда протокол об административном правонарушении составлен неправомочным лицом, то есть тем, кто не имел права этот протокол составлять, а также в случае неправильного составления протокола и оформления других материалов дела либо неполноты представленных материалов, которая не может быть устранена при рассмотрении дела, судья или должностное лицо выносит определение о возвращении протокола и других материалов дела в орган, должностному лицу, которые их составили. Материалы дела потом снова возвращаются судье, должностному лицу, которыми были отправлены, в течение суток после устранения недостатков. Это возможно только на стадии подготовки дела к рассмотрению, а не при рассмотрении дела по существу. В подобном случае надо отследить, были ли соблюдены сроки рассмотрения дела об административном правонарушении, которые составляют 15 дней для рассмотрения должностным лицом и два месяца для рассмотрения судьей.

Статья 28.9. Прекращение производства по делу об административном правонарушении до передачи дела на рассмотрение

1. При наличии хотя бы одного из обстоятельств, перечисленных в статье 24.5 настоящего Кодекса, орган, должностное лицо, в производстве которых находится дело об административном правонарушении, выносят постановление о прекращении производства по делу об административном правонарушении с соблюдением требований, предусмотренных статьей 29.10 настоящего Кодекса.

2. Постановление о прекращении производства по делу об административном правонарушении по основанию, предусмотренному частью 2 статьи 24.5 настоящего Кодекса, со всеми материалами дела в течение суток с момента вынесения постановления направляется в воинскую часть, орган или учреждение по месту военной службы (службы) или месту прохождения военных сборов лица, совершившего административное правонарушение, для привлечения указанного лица к дисциплинарной ответственности.

Комментируемая статья устанавливает правило, согласно которому орган или должностное лицо, в чьем производстве находится дело об административном правонарушении, обязаны прекратить его и вынести постановление об этом с соблюдением требований к постановлению. В постановлении обязательно должны быть указаны обстоятельства, по которым прекращается производство дела об административном правонарушении. Эти обстоятельства перечислены в ст. 24.5 КоАП РФ. Данный перечень закрыт и не подлежит расширительному толкованию. Для прекращения производства по делу достаточно наличия одного из указанных обстоятельств.

Рассмотрим эти обстоятельства.

1. Отсутствие события административного правонарушения. Событие административного правонарушения – это реальный факт совершения физическим, должностным или юридическим лицом деяния (действия, бездействия), предусмотренного конкретной статьей или частью статьи КоАП РФ. То есть если не было самого правонарушения, то не может быть и наказания за него. Например, такая ситуация может возникнуть, когда вы, предположим, поставили автомобиль вечером на место его ночной стоянки и решили выпить на месте бутылку пива. Вдруг появляется сотрудник ГИБДД и намеревается наказать вас по ст. 12.8 КоАП РФ. В данном случае нет события административного правонарушения, так как вы не управляли автомобилем, а за то, что вы пили пиво в неподвижном автомобиле, никакого наказания не предусмотрено.

2. Отсутствие состава административного правонарушения. Состав административного правонарушения образуют четыре элемента:

• объект правонарушения – те общественные отношения, которые оно нарушает;

• объективная сторона правонарушения – признаки конкретного деяния, его возможные последствия, причинная связь между деянием и последствиями;

• субъект правонарушения – физическое (в том числе должностное) лицо, обладающее признаком вменяемости и достигшее определенного (в России – 16-летнего) возраста, или юридическое лицо;

• субъективная сторона правонарушения – вина в форме умысла или неосторожности.

Если отсутствует хоть один из элементов состава административного правонарушения, то не может быть и производства по делу. Здесь нужно обратить внимание на то, что при производстве по делу об административном правонарушении должностные лица не мотивируют должным образом, а то и вовсе не отражают субъективную сторону состава правонарушения. А между прочим, если умысел, к примеру, был направлен не на то, что вменяется в вину, то речь должна идти или об освобождении от ответственности, или о переквалификации действий.

Основание прекращения производства по делу об административном правонарушении дополнено и такой причиной, как невменяемость физического лица, которое совершило противоправное действие (бездействие). В этом случае дело также подлежит прекращению.

3. Действия лица в состоянии крайней необходимости. О том, в каких ситуациях речь может идти о наступлении состояния крайней необходимости, мы уже говорили в комментарии к ст. 2.7 КоАП РФ. Если будет доказано, что ваши действия продиктованы именно крайней необходимостью, ни о каком привлечении к административной ответственности не может быть и речи.

4. Издание акта амнистии, если такой акт устраняет применение административного наказания. Акт об амнистии может принять Государственная Дума РФ, он должен быть одобрен Советом Федерации и подписан Президентом РФ. Акт амнистии применяется только к тем деяниям, которые были совершены и признаны оконченными до его принятия. Акт амнистии обязательно должен содержать положения о том, что он устраняет применение административного наказания.

5. Отмена закона, установившего административную ответственность. Если вас не успели наказать по определенной статье Кодекса, а ее отменили, то ваше дело должно быть прекращено. Здесь стоит обратить пристальное внимание на сроки, когда именно вступает в действие отменяющая ответственность норма закона. Такие сведения содержатся в самом принятом законе. Это может быть немедленное вступление в силу, либо вступление в силу по истечении какого-либо срока с момента официального опубликования закона, либо законодатель устанавливает какой-нибудь конкретный день, когда закон вступит в силу.

6. Истечение сроков давности привлечения к административной ответственности. По общему правилу постановление по делу об административном правонарушении не может быть вынесено по истечении двух месяцев со дня совершения такого правонарушения. Но если в результате совершения административного правонарушения был причинен легкий или средней тяжести вред здоровью, то срок давности привлечения к административной ответственности составляет один год.

Если вы ходатайствовали о рассмотрении дела об административном правонарушении по месту жительства, то срок давности приостанавливается до момента поступления материалов дела к судье, должностному лицу, которые будут рассматривать дело уже по месту вашего жительства.

7. Наличие по одному и тому же факту совершения противоправных действий (бездействия) лицом, в отношении которого ведется производство по делу об административном правонарушении, постановления о назначении административного наказания, либо постановления о прекращении производства по делу об административном правонарушении, либо постановления о возбуждении уголовного дела. Речь идет о том, что никто не может быть подвергнут наказанию за одно и то же правонарушение дважды, а также если это деяние является не административным правонарушением, а преступлением, то наказание за него должно быть уголовным.

8. Смерть физического лица, в отношении которого ведется производство по делу об административном правонарушении.

При наличии одного из перечисленных оснований производство по делу об административном правонарушении не может быть начато, а начатое производство подлежит прекращению.

/9j/4AAQSkZJRgABAQEAZABkAAD/2wBDAAICAgICAQICAgIDAgIDAwYEAwMDAwcFBQQGCAcJCAgHCAgJCg0LCQoMCggICw8LDA0ODg8OCQsQERAOEQ0ODg7/2wBDAQIDAwMDAwcEBAcOCQgJDg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg7/wAARCAMJAjoDAREAAhEBAxEB/8QAHgAAAQMFAQEAAAAAAAAAAAAAAAUGBwECAwQICQr/xABtEAABAgQEAwQFBAcRCwgHBgcBAgMABAURBgcSIQgxQRMiUWEUMnGBkQkVobEjOUJSwdHwFhgkMzRTVmJydXaClbO00+EKFzdDc3eSsrXU8SU1NjhXY5eiGSZEVXSDllRYZJPC0jpFZZSjw8T/xAAdAQEAAQUBAQEAAAAAAAAAAAAAAQIDBAYHBQgJ/8QASBEAAgECBAMCCgQMBwADAQEBAAECAxEEBRIhBjFBUXEHEyIyYYGRobHRFHLB8BYXIzM0QlJTkqLS4RU1VGKCsvEkQ+LCc4P/2gAMAwEAAhEDEQA/AEePi8/TQIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIA5u4osCjFvDdM1mVZSur4bWZ5pf3RlyLPoHu0r/wDlxv3CGY/Qc1VKT8ir5L7/ANV/Z6zkXhFyb/FMgliIL8ph/KX1f117LP1HuX8n1n4eIL5MzBOIqnPqnsYUJJw/iZx0jW5NyyUhLptz7VlTTl/vlK8I+kj4oO2oAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAoTZJMAfO78qXmhUs6vlEsvOFbDs8UYew4W57ERZuQJ59srUpYtY9hKEEHld9V48nM8dDLcBUxUv1Vsu19F62bDkWVVM6zajgYba3Zvsjzk/UrmaTlJan0iUkJJoMSUqwhiXaA9RtCQlI9wAj5JnOdWbnN3bbb73uz9DqVKnQpRpU1aMUkl2JKy9xsxbLoQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBjeZZmJR6XmWw9LOtqbebPJaFAhQ94JEVRlKMlKPNbrvKJwhUi4TV01Z9z2a9aG78llj2YyW+VOzM4cavM/8AI+KmFrpanXAkqm5JKnmSAdvskqt2+/NCY+uMsxscxy+lio/rpP19V6nc/O7PMslk+b18DL/65NL0rnF+tNM+jrmLiPWNfCACACACACACACACACACACACACACACACACACACACACACACACACACAGjj7GNIy9yRxdjuvvJYouHqPM1OdUpVvsTDSnFAeZ02HmYA+VLh2mq1mjxFZt5+4utM12uVZ4peNyEvTLhffCL8glBbbA6JNo43x5jrQpYKL5+U/VtH33fqPpXwUZWpVMRmc15toR73vL3WXrOx44mfT4QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBxzmxXprJb5SLJLPanpKG5KpSsxOHRrSv0R5IdSR+2l12jvXAuL8ZgamGfOErrul/dM+S/Ctl3ic1o46K2qxs/rQ//LR9ZtOnpSp0GTqVPfRNSE0wh+WebN0uNrSFIUD4EEGOrHz+bsAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAeYnytOZ6sA/JOVfDcq+GqjjmtStDTYqCgwkmafIsOqWAg3IFnOvIgeZGQ+GPzJ8KGD6e42G5yalPnCb7pSS4+e03v1CChP8WPljiPF/Tc6rTXJPSu6O3xuz744My7/DOGsNSatKUdb757+5WXqJejVjfAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgDl7i3oHztwrpqqEku0arMvkpTc9m6Cyve2wupB5gbb9I6NwVifE5x4p8qkWvWrNfacY8J2C+k8N+PXOlOL9UvJfT0r72Pf/gTzB/vmfJKZG4kcfS9Os4bbpU4e11qD0kpUooqOpRuexCtzfvAkC9o+ij4yOtoAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIA+eb5YvE7+LuNrh8yWlpglhmQVUJhlKSLuT00JdJKiLbIllcr21G/SMPF11hsLUrv9WLfsVz08uwrx2YUcMv8A7JRj7WkXoaal2kS8ugNsNJDbSQLBKUjSkfACPjxylJ6pc3zP0fjGNOKhHktl3LZe4uiCoIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAjrN2korfC5j+mqSFFdDfcRdBV3mk9qmwG5N0C3nHvZJWdDOMPNftpe3b7TU+KMMsXw7i6T605P1xWpfDY7p+Rsxc5W/kwa/ht7tFKw7jebZZKkpCUtTDLMwEptubLW4SVffWBsLD6yPz3PXCACACACACACACACACACACACACACACACACACACACACACACACACAKHZBPlAHy+cUFZOYP9024s1G8lhp5mUZS632ah6HT0qNrE3+yqUQTzFrjpGl8V1vE5DWt+taPtaXwOm+D/DLE8WYa/KGqX8MW177E4DkI+Yz7nCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACANadlkzlFnZNaihExLONKUnmAtBSSPPeLlOThUjNdGn7Hcs1qaq0ZU3ykmvamhy/Ih1xYe4i8LiWBZaXR50TGs3J/RTWnTa3JN73j7LTukz81JK0muw9+IkoCACACACACACADpABABe0AWlQB5H/RMAVCgbdPaLQBWAKXHn8IALjz+EAFx5/CAC9/8AhAFSQBcmwgDXempeXSC+8hhJNgXFBIJ98AZG3m3WQ42sLbO6VpN0n2HlAGSACACACACAKHlAHybYTqy8afLT8R+MVOvhDlarK225pfaOaF1ANISVX20pSABysAByjmHHVTTlVOHbNe5NndvBVR15/VqX82k/fKKOto+fj6+CACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAMjO84yDyLifrEUy81lUfOXehv/I6qUj5SHiCYQooZOHHCW0mySRU0gG3LYE29pj7Fwe+Ep3/ZXwR+buZJLMKyX7cv+zPowjNPLCACACACACAPIv5U3ODMqmUvJrh+yRq9VpuZ2OayucJoVQckp30ZgaG2w8hadCXHVqJJIFmVXIF4AmX5MnPefzu+TKoTeJa7MV7HeEZ16h12Znphb008EntJZ5xayVKKmlpTqJJJbVfe8Aeh8AcBfKZ45xjl58kZjvEuBMT1PCGIW6jTWG6lSJxctMIbdm0NuJS4ghSdSSQbEHeAORco/k2BnDwy4IzTx/xT5tVTEOK8LU+qNlqsD9CF+WS52SlPKdW6lJWAN0bC3XYBDx9wn8avB/l5O5m8PPEziLNTD2H5X0mo4MrrTjpVLIup4tyzrrrLoAK1lKOzctfSSoCAOy8ic60/KA/JTYjbpGJJ/KLMF9HzLiGdw864H6POJ7N0PyqtaFdm6iyk9+6QpSColJJAiA/JqZpFRP5/rOf+U5n/AHyAPP3jRylzr4Vc18ksN0rjAzYxg3judmJeYfnMSTsuZINPS7YKQmZVruJgmxt6o8YA9Af/AEamaRJtx9Zz2uf/AOaTP++QBMOS/DJVuFTHeI83sy+LrHGYmDpDDsw1PyeN6k583SSCptwzSi5MOAKQGykd2/fIHOxA4Oxvx08VPGNn7WMpeB7Cs1hnCMqvs5zGDjSW5xTJUoCYdmHR2dPbWEkoQAX1aTY6iUADnHiV4PEZC4Twli/jB4h8f44ncUTb7bbmEKGKy3KTjaEqV2sxUJ5lSits90pbBOhXIAQBKWAuCDikofDVhHO/g44iMRooFYpSKtSsK199dDqC5chSmm1NNvzEk6pQJUErUlFl78zAHVvCL8o9iCt56McPHFph5zL/ADhE6in0+quU5Um1UJlVwliZYItLuq7uhaPsTmoW0d3UB7DA3SDAFYAIAIAscJDKiOYFxAHyHcLU49XOI/OrENRCHqtNvds8+Gwm6npx1blgNgCoA2G2w8I4/wAfSl4jDxvtql8EfR3gkhF4vGTa3UYL2yd/gjuCOHn1MEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAVT+mJtsdQ+uIfIlcxkfJYz83JfLp520iUd9Hpkzh6sF+XQhIQot1OXLfTa2pVrW5x9cZQ3LKsO3+xH/AKo/O7iGMY5/i4x2Sqz/AOzPpKj2TWwgAgAgAgCivVPj0gDw3yB08WP90z5s55C03gHKWV+aqApaboceQHJRhSTciyl+mTAN+qdoA1uFx386l/dIud3DzOOKl8GZkpVU8NagENh0hc9LJAFhYNrmmNhupCR42A90QbgGAPNn5WX7Srj/APfmkf05uAOq+Fb7Wbw+/wCbqjf0FqAJSxxivDeB8o8SYuxfPy9NwxR6a9OVOZmlgNoZbQVLvfY3GwHUkDmYA8jPkaaRPfne898Yt0RykYWr+N0fMpWkJSpLTSytCR1DfaoTcbXuByNgPZ2APCP5YP8A60XBx+/E9/SqfAHu2n1fefrgDw8+VSzNxnmLn5lDwTZZvL+dMXzcrP15CNSEvl19TUmytXItJKHH1gj/ABbZ6QBFuc+SvEtwLZ6ZX5hZH0BzEvDrgLspialaEtbj8+860lqpTVYZTZbjr47QIdAW0y2GkpLekggdzcbuE6dxk/Is0jEmVIXiNU9UaRXsNdi3rdUHH0yzqVJSdlttzDwWknuqbUCRYkAJ3HNmbiTKLgtwTwtZBUupYhzgxnR26BQ5CisOOTUhSWG0y7813TdskANJWogDU4oq7hMAcRY9+T7zzn/kXX61m3N0+qZ1ZdSoncHS1PPpFSlKIylSn6RMzaSUzAbF3ZdCdXYlCkJWUr0pA9Lfk5+ISe4hfk1cM1bEU6J7HGGXlYfxA8o9+YcYSkszCrkklxhTRUo2usLNhAHeMAEAEAWO/pC/3J+qAPkD4Q/8LebnsZ/pLscc4+/NYbvl8EfSXgj/AD+N+rD4s7rjiR9RBABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABAF7Y1TTSTyK0g/GIfmsqjvJL0jc+SJZYq/wAq1n/Xp6XbdqqMOzSm3wmxb7Wpt9oEjkAdI+EfYGXwjTwFKEeSjFe5H5x5xUlWzbEVJc5Tm365M+jSPRPFCACACACAOYOMnOYZC/JvZpZisOobrMtSjJ0UKUQVTsyQwwRbnpUvtCPBBgDnv5LTJdeVPyWuHq/VZBUrivH00vEVRceSoPKYX3JNKr9OxSHB/liesAc+fKy4NruBsS5DcXWBmAxiPAmIGpKozKEpCi2XBMShX1KQ4h1s7EfZx4wB69YDxhScwclMJY6oLoeo2IKPLVOSUFBX2J9pLiRcdQFWPmIA4E+Vk+0rY+/fmkf05uAOcsk8wvlTZPg1yrksAZFZWVXA7OEKe3h6fn6qlMzMSQlkBhxxJqKbLKNJI0p36DlAHHPE1X+NWo42w9KceOG8ayHDzJzzb1WlMtpSSRIuqA7pMw2VtFRN7B9Zsb6AkkGAPfXhaxJkhiTgcwK7w8uyycrpKT9Dpsk0SHpBaDdxiYSolaXwpRUvWSVFWq6goKIHQsAeEfywf/Wi4OP34nv6VT4A92h+ln2mAPnYzKxJW5H+6kM/sZSLLdRxNgXLiqVPCiFy3aJampXDQcYu2m3a2U4rY3vfyEAdF8OPGZ8oFj+Up6cR8G6sbUhaE2rjLjmFQ4ghJ7TVOlTLhIJPcCQbjkATAEB/KW50ZwcP+JsqcAZOic4esK4hobuJa1KYPmhKdtV3nymZZ9IYCQQ3pQpQa0pWp4rUCVAwB1LwPZxZ44q+SwczocyYGdWcRq79DRWHKtJUqp4jpkqAplb028n7KGXHHWQDcq7NR3Xe4EYVfje46Zrjdyzy8xdwyIynwPXsYSVKqYnsPTlUL8q/Mdk8kTtwwoBorVqQkeoVercQAofI4y0nTJ3i1olIqJqVAkMYybVOeSodm62DOIS6kDujWhCDdPMAdAIA9tIAIAIAxu/qdf7k/VAHyC8If+FzNz2M/wBJdjjnH35rDd8vgj6S8Ef5/G/Vh8Wd1RxI+oggAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgCoUUKDgFyg6hfy3iLX2F7O/YavyLUozVeKviNxW8FtT7dJkmUNoV9jCZmbfdXcEXJBYQBvyvzvt9lUaapUYwXRJexH5rYqq6+JnVas5Nv2ts+h2L5iBABABABAHiP8ptU6ln5xxcOHBVhCqrk5utVQVfEbzaFOolEOBTbLi2wQF9kyibeKbjYp3F7wBJ8l8nNn/TqNKU+nfKJ5qSFPlWEMSsrLMzLbTLSEhKEISmoAJSlIAAAAAAEANTMT5MnPDGeTFfw/X+OzMLH8i9LF1FAr8s+9JTz7f2RlDqVz6k27RKO9pOk7gXEAPD5IrN1/FnARXMoK++6nFuWlbckVyswq7jclMLU4yN/vHRMN26BCfEQA/flZftKuP/35pH9ObgDqvhW+1m8Pv+bqjf0FqAJqq9JpdcwxUaPWqfL1Wkz0suXnZKbZS6zMtLSUrbcQoEKSoEggixBgDws4JZf879/dHHEZw4YTffOWs/KzMzJ04vEtyimQzNS3rXJLbUw4ze9yLE3sIA95YA8I/lg/+tFwcfvxPf0qnwB7tp9X3n64A8E+P1Nb4YvlxsieMGXkXJ7B1QSxJVgs7q7SXQpiZa3uAVyboUjxLa/CAJ44s/lMRlti6iZW8P8AgiYx7mPiaQkpmhVupSy00t1qeShUo7KI2XOlwL0ixQhKwQSopUgASRne8xkN8jYxjDickaJxBZgMVaSnKsnGVIYn5IVGenGkvsyrBGhhphguIQGgBZrVpOoggJPF9mvm3wgu4Iz7yjlZTGHD7MMStIxVgOYQmXkqYnf0SbkVIGqU7VK+yVZKm9SWypBKtgLMX/KT5QV75JDH2deCX56l4oaaNCp+H6s0qXmEVmYZ7jSFp7j6W0qLyltKuEIuQgkCAEv5InJyqZd/Jyz+Pq/Lql6vmLWPnWXDg+yKkGUdlLLV176i+4L/AHLiT1gD1agAgAgC1Qum1ri8AfJNkvKv4c+Ui4isJrkk0huXqtQbVIFkNlgs1JSUoCegSlZFhta3hHJuPKaeCo1LcpNe2L+SPoTwTVXHNMTSvtKmn61JfNnY8cIPrAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAbWM6g3SsnsWVN0am5WizbpTrCNVmV7XPK8Z+Aputj6NNfrSivejyM2rxw2VYis+Uac32fqs6E+RLw5MSnCXnLitxLyGapiuVkWgtgpbV6LKaipK/ujeZsR00jxj7BPziPbWACACACAMEzMMSlPfmZl1LEu02pbrqzZKEgXKiegABMAeIvAE0/xMfLF8SXGBWmlTFIpk0aJg9aidDaHB2SNN+qJNlAI5XmCdrwB7gwBQi6bQB4ZyPb8JH91aTckQmQy3z1ldbe1mkzM0oqHgAtM80odbImOl9gOpflZDf5FPHx//rFI/pzcAdG8J2K8MTXyZuR/ouIqXM/N2X9IZqHZVBpforiJFoqQ5ZXcUACSFWI6wAgZ3ccXDZkXgGYqmJMy6PXqwWC5I4ew7PN1GoThsSlIQ0pQbSq1u0dKUefSAOEvk38s8wc1eMnNrjrzToPzCvGvbMYQlHEqGtl1ae0faCjq7JDTTbCFn1wFkbQB7TwB4R/LB/8AWi4OP34nv6VT4A920+r7z9cAQlxDZC4K4keFnEOVmOGVJkJ9AdkagyhKn6ZNoB7KaZv92gk7fdJUpJ2UYA+fWgv5o/J0cT2DabxI5MymcOWGHqs9MYCxay2VOUpTmsLcp0yruo1ai6qRmLBLn2RGhRLigJv41eJXJrjl4ZsAYIytz0wzliiSrDtXxDS8ykz1IWrQyG5dKVsyz7LhBddJSHfAgG1wBImI/lBuGjBvyV9DyOx/Os8ROMm8HIwziGm4SQ+1S5tTTXYBz0+YYaCUlKELDjTa1JVYpBteAOeeGvhGzR4zsaYFxRmnhZeUHCThRpX5jsIU9K5ZE8wtYWpuXCz2rpeslT9Rdu49ySo7dmB9HtMpshRsPSFJpUmzTqZJS6JaUlZZsNtMNISEobQkbJSlIAAHICAN6ACACALVEhtRHMDaAPlax5SkYF/uj3POhOMOywqlYqT7Im3AFn0ppE8lSdu8FXOkfekcyI59xpSdTI5SX6sov32+07F4Mq8aPFEYv9eE4+7Vt28jpOPnA+0ggAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgCEOI2sCj8GuM1hYS7OtNSLYsDcuupBFj+1CuW459I3Dheh4/PaK6RvL2J/a0c448xSwnCmJfWaUF/ykr+6561fJW4Hdwb8jbgKbmGlMTWJ6jP111CwsGzj5ZaNlcgWmGyLbEEHe94+oD4SPRmACACACAG/izDNKxpljiLCFdbdeolbpj9OqDbMwtlxbDzZbcSlaCFIJSojUCCOkAR1kbkHlhw6ZMuYCyooC6Bh1yoOT7zT067NOOvuBKVLU46oqPdQgAXsAIAmWACAOfc5+GHJ7PvG2BMSZj4fmajXsHTaprD8/I1aYknpVZW256zKk6hrabUAb2I2tcwA7c5smMBZ95C1LLXMqmP1fCc8+y/My0vPOSq1LZcDjZDjZChZQBtfeAPPr/0OnCUNemfx8gKJuE4lZt/RoAmzLr5Njg6y3rMpU5DKSVxNVJbQW5nFE89UwVJHrll1XY3J3P2O1+QHKAO6JeXYlZJmWlmW5eXaQENNNICUoSBYJAGwAGwAgDNAHO+d3C1k3xDYuwPXM0aBN1qo4Sfceoa5arPygYUtba1FQaUAu6mW/Wvy8zAHRAFhABACTW6BQ8S4WnaHiOjSNfok432c3T6lKImZeYR96ttYKVDyIMAcX4s+Tc4MsXzMzMzWSlOok4+tKlPUCozdOAt0S2y6G0g9bJF4Ae2XXA3woZWYgZq+EMkcOtVdpCQ3PVRtypvNlI2WgzS3AhfUqQATAHVyUIQgJQkJSBYAC1h4QBdABABABAAdwRAHzU/KN0M5cf3QPgDHZZTLU/FFLpk07MNtpbClJK5B7UokgnQhBKrDYgcxeNdz7DvFZPiKS3bi361uvgbjwpi1geJMJXbslNJ90vJfP0MkIpKVFJ5g2MfKN77n6B2s7BABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABAHGPGNV3ncHYGwZIpcfn6nUlzXYNXKl6EhpsWHO63TbzG3WOucB4bVia2JfKKUfW3d/BHzv4WcaoYHDYJPeUnN90VZe9v2H1JZJYEayw4QcssvG2kNHDuGJKnOhCQkKdaYSlxVhtcr1E+ZMd0PlMlCACACACAGHmfmThXKDILFWZWN5xchhbD8gqcqDzTRcWEAhIShI9ZSlKSkDqSIA5EyZ+Ug4a89eI7D+VuCqjiFvFVa7YU9NToKpdlxTTSnVJLmtViUoVa4sSLX3EAd79LwBwhnd8orw68P/ABH1vKzMCZxI3imlNS7k0mn0EzDNn2UvI0r7QX7qxfbntAETH5XzhCCSfTMYmwJ/6LH+tgDrvNriqyZyQ4b8J5p5j16couFsSpaFFLVJfmX5lx2WMy21oaSrQotpO6yEg7FQgDkuV+V24P359hp6q4tkmVrCVzD2FXC20Cd1K0LUqw5nSCfAGAO8cp86MsM8srWsZ5U4yp+M8PKc7Jx+SWQ5LuWCuyeaWA4yuxB0LSDYg2sbwBG+f3F5kLw0yMsnNPGrdOrc0z20lQpCXXOVGZRqCdQZR6qbk95wpSbGxNoA56wd8qrweYux7JUB3GdWwk5NrDbE7iGguy0nrJACVupKw2N/WXpQLbqEAduY9zNwpl3w3YjzWrc4uawdRaMurTM1TUiZLsslGvW0Emzl0kEWNiDzgCDuHDjOyZ4psRYrpeVj9aemsPSzD9QFVpJlAEvKWlGk61ajdtV+UARZjX5S/hnwXxK1jKdU5ibFOMafVxSVMYbw8qfRMzmoIMuypKx2iw4ezsB64IF4A7WxTjeiYKyQr+YGJlP0rD9FoztVqZcZu7LsNNF1wFAvdQAI0jrtAHD+WXynfC9mvn3hLLjDNRxGziHEdQRIU41Gg+jsF5YOhKnC4baiNI2NyQOsASrxHcbGSnC3jjDeH80nq4zUK3IOTsl81UgzSOzQ52atR1psdXSAOcf/AEvnCF/9txj/APSx/rYA6G4c+ODI/iizOruEsrn667VqTS/nKbFVo5lWwz2qWu6rWq51LG3heAOwoAIAIAIA8NPlrcBOuZR5JZt0+WUmbotbmKPNTbQOpCZhsPsaiByC5dy11CxVsDckUyjGcXGXJlyE5U5qcXZrdd6IYwrXGsT5Z4exGyQpup01ma2PJS0AqHM8lahzPKPj7GYeWExdTDv9STXse3uP0dy3GRzHL6OLjyqRjL2rf33F6MI9MIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAOQgDm7K3CX54T+6DctcG9h86YYwnOtTVUQo3aSzIAzT+q3RT+hrzJAj6T4PwjwuSwnJWdRuXqey9yR8TeEbMlj+JqlOLvGilD1reX8zfsPqkAsnz6xvpyQrABABABAHjr8stm21hXgSwllTKvAVTG9eD80gOWIkZGzq7gc7vLlxvtsYA8Vq7hHEvCLxB8LWakql5mbqeGKPjhhSlEJWpT6y6xcX2LaUgjwc5bwB9jtErFPxBgmlV+kzCJylVKSanJJ9B7rrLqAtCh5FKgYA+Zriyw1hDNT+6vKfgbETSK9hWs4pw5R61KMzS2itCpSWbeaK2yFIVYkEpII8YAY3yoXDdk7w38QOWFCydwovCtMq+HJmbqDS6rNThedRMFCVXfcWU2TtZJA8rwB2X8qX9pH4Vf3xpX+xHIA4gy3rHAfIfIkYhlcyaVLVPiZmmqo1R/m+WnDUWXys+guKcFmEtp7pOo7oBFiTYgdTfJHU/G+WWRXEfn3X2ZmQyilcNlyWTNvdjLVSbkQ684tsq6NIBaK7Wu7puSkgAcj8J2VFS+UC+V0xFXc3ahOTtEeD+JsXqlnFNqfaC0NsyTbgH2NJUttsWIIabVpIIBAHoN8ot8n1kdgjgHrOb2S+D2sA4hwgph2oyslOuqlqjJLdS0vWh5arOILiVJWkgqGoKCrpKQIa4Sc3a/jP+5ueMbLGvTUxUGcCYcmPmZ55QIYk5xhxYl0m97IdZdUL8g5YbAAAcHcL3FLO8M/D5xEIws49L5kY1pNPpOHJtCDpp4Dj5mJvVyC20LAbF/XWlW4QQQPUT5Jvg3phoEnxW5heiVusTa3U4IkfSETHoVipDs6+LGz5Nw2CboSSsjUpOkDqf5WnNYZffJU1LCknO+jVnHlXYorSEpupUsg+kTJvfYaW0oJ3/TLdbgD52MVZV4uyMyo4ac8E+lScxjGVer1LU4kJDD8lUCG9BA5KaEu6L7/ZPC0AfUpijh94a+N/KLK7ODMXBq8WIm8MMzNGdark5J9gzMpS+pshh1AUQskG9yCCIA+eer5D5WSv90htZAMYaUjKdWZMtRzRfnGYJ9EWlBU325c7b7o97Xq84A+kvIvg64e+HDHtXxPk/gd3C1aqlO9AnX11ydnA4x2iXNOl91aU95CTcAHbnAHT8AEAEAEAce8emUys5Pkp83cLykmmcrknSfnqjpKSVCZklCYARY+stCHGx+768oA8FeFHE4r3CrL0txzVNUGeckykqursl/ZWif8ASWkfuY+ceMsH9Gzl1UtqiT9a2fwT9Z9p+DXMfpvDaoSflUZOPqflR+LXqOmI56dhCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAELE9elsK5c13Es5+paXIOzSwfutCSUp96tKffGZhMNLGYqnh485tL2v5Hm5jjaeW4CrjKnKnFy9i2XrdkSz8jRlXUJ2Xzh4jcSS63ajXJ0USlTbyLF0BfpM64knmC4phFx1bUOkfX1KlCjSjSpq0YpJdyPzmxFerisROvVd5Tbbfa27s92IvGMEAEAEABNgTAHyw/Ke4wxFnv8tDLZTYLadxFM4dYk8L0amy9h21QfIdeSCSBqLjqGyokAdnuRaAIw4t8Dcer2SeDsTcU2EXpfBWFVik0Kd9Eo7aZAPJSlLN5E69BDCQNd0gpG91bge2fyd/EbhKe+RHwviHMfGVLw/K4Bdew7WKlVp5Eu2yhghUqkqWoXUWHGUpHNRFgCeYHj7w7Y1wpnv/AHRm9nljrF1EwPg2XxVOYrM3iWsM09CWmLpkGEqdcQFOBXo40Ak2Qq4IBgCS/lhcwsA5g8TeUE7gLHOH8cScphWaampigVmXn22VmaJCVqZWoJURvY72gCcflMMQUHEvyFvCvUsOVuQr9OTWadLmaps43MNB1ujuocb1oJGpC0lKk3uCCDYiAIe4d+Gfg6xz8hZWM0c3KlK4PzIlBWHPzRNYmcammiytSZVHoZcU24CrQkIDWpdwAbkGAI9+TCfx9mFjrPnh4kqvOuYDxhlVVkTcg5OqTLSc2oIZZmUJIUlKyXihRAF0m5vpAgBvfJq540fhj+U5rGHs1ZtOEKDX5F7DdYmKgQ01S55p8KaU+oi6EhxtbSiSEp7TUo2SSAPWP5T7idypovyZWL8taNjOh4nxzjRMvJSVJplTbmnWJcPNvOTToaUezRobskqtqUoWBAVYDgHgxwBX6N/c9vHTmJUpdUrRMT0ByTpGtFjMehS73bOJN9065gIvb1kK8IAgT5PzhDwNxdS2euHMU1So0Cu0WjST2G6rIOgolJl1x5JLzRFnWz2aAU3BtfSQd4AlT5NTM7GPDn8rzUuHrGk89TqLiGpTeHaxS1uKVLs1eXKhLvoFwNSlNlnWB3kupvewsAr/ACwOZkzmL8o3grJ3DgcqasIUhuXXKy7hWpypVBaXC2EDbV2Ylk8r3UR5ACC+I3Kzj/kuCvCzXEBgt2nZOZcNMy9GPYUVtNKQ4G5VtAMortlhVm0m+reyjvvAHsL8kLm03jn5MZ/AEzMdrWcA1p6RKFuFS/Q5kqmZde52GpT7YGw+xwB5pV7/APjC2P8APFJ/6jcAfUUPUHsgCsAEAEAEAY3m0OyrjTiA42tJSpJ5KB2IgD5R2sHnhp+WVzdyLdS9L4dqE858wdvfvsq/RckrUfWJZcU2VdVC3PlzTjbA/SMsWIit6Tv/AMXs/sfqO3+DDNVg88lg5vya6svrR3j7VqXrR1R0j56PsUIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIA5H4p8R1GoUfCeUOF2VVLE2Kqi0DIMDU68ntQiXaA8XHiLfuI6xwPl3jcVPHTW1PaP1nz9i+J8++FLOlh8vp5XTflVXql9WPL2y/wCp9LnDdk9TsheCHLnKqntthyhUhtuoPNpSPSJxf2SZdJAF9Tq1m/haO8HyaThABABABAFCLiAPNrAXyaOWWCPlDJXiNezBxZijFjWI5uuqkqqJUyzszMdqdSihsL7indSd+aUwB1/n9klhfiG4TsV5RYtmJqQotcaaC5yQ0CYlltPIebcb1gpuFIHMWIJHWAPFri84McJ8IPyN+Z8jg3HOIMU0zE+L6C6/KV1EtolnmFvpDjRaQkgqS5pVe9wlPhADb4TPkqsts9+ALL7NrGWYeJ6JW8RsTEyqTo3oqpdppMy403btWSrUUtgqFyLnaANzio+SrykyG4Acys3KBmNi+sVjDcg1MSsnUUSYl3lLmWmiF6Ggq1nCdiNwIAd/Crwk0Xi9/ufPAOBqrjGdwSuj5i1Oqy09JyDc0FrBUyULbUpNwUuGxChYgcxtADlpvyIeCGaywur5+V2fpwv2zEnheWl3l7G2lxTzgTvY7oO223OAPTLhp4Rsm+FbAdSpOWVImV1OpqQatX6u+mYqE9o9RClhKUpbTckNoSlNySQSbwBAXFJ8mhkjxK5iTmPGp2oZZ5iTgHp9XorLbsvUFAW7SZll2C3LWBWhSFKsNRVaAOcsB/IrZRUPH8tUse5q4ix3RWVBfzRJ01mkpfIPquOpW4vSfBGhX7YQB6fYwyHwNiPgbxBw/wBGk/zEYDqOHXaGwxRGkIMjLrFj2QUCnVuTdV7kkm5MAQNwj8CuAeELFeN6tg3GGIcTu4mlJaXmkVpMuEshhbi0lHZITue0N7+AgCNs1/kycrczOOepZ+yGYOLcA4xmqtLVcN0QyymWZ5nQRMI7VtSgpSm0rIva9+htAGV35NPLeqfKLNcSeJ8xMV4mxaMVt4hdp803KJknHmlBTTRCW9YaRobATf1UAQB3Bm3lhh3OXhpxtldiovN0HEtKdkJt2V0h5kLF0utlQI1oUErTcEXSNoA5b4SuBTB/CHjrF1XwVmFifEcpiOntS1QptZTLBjW0sqbeT2SEnWkKcTubWWfKAG5O/J1ZbTvyoCOKZeOcToxYnFLWIBSEplfQe1bCQG/0vtNB0j7q8Aeho9UQBWACACACACAPDH5YXJmoyH97Dimwk0lqqYbm2qNXnUEhfZl0uyTp3HdS6XWj1+zJ6csfEUaeJoSo1FeMk0+57Gbg8VWwOKp4mi7Sg1Jd6dyGcKYkkcYZbUPFFOI9DqkmiZQhKr9mVDvt+1KgpJ/cx8i4zCVMDi54apzg2vk/WrM/RLLcfRzTL6WNpebUin3X5r1O69Q4IwT1QgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgDVnp6TplEnKlUJhMpISjC35l9fJttCSpSj7ADFynTqVqkadNXlJpJel7IsV61LDUZVqrtGKbb7EldsSvkzcppviF+UexjxQ4tkVKwng2Y7HDjDwugz60aWEjex9HYPaHwccbMfWeVZfTyvAU8ND9Vbvtb5v2n58cQZxVz3N6uOnyk/JXZFbRXqXvufRkAALDlHsmslYAIAIAIAIAIAIAbmKcHYRxzhZVCxrhakYwoinUOqp1bprU7LFaDdCy26lSdSTuDa46QBt0DD1Awpg+Rw9heh0/DdAkm+zkqZSpNuVlZdNyrS202AlAuSbADcmADEGHcP4swfPYexTQqfiWgTqAicplVkm5qVmEghQS404ClQuAbEHcAwBq4XwfhLA+FEUHBWF6Rg+hodW6inUSmtSUslazdag20lKQVHcm1z1gBxQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBG+b+WOG85eGbG2V+LGe1oWI6U5JTCgm6mFKF23kft21hDifNAgD5g8k2cUZOcReYfDNmM2JLEuH6k6uRSpQ0uEWLgbPVDjZbfRbmkqji/HGV+bmFNf7Zf/y/s9h9NeC3PvzmT1n2zp//ANRX/Zes6wji59NBABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABAEA59YfzHxthOlYGwTTW0UepzCDXqu/OttIYaCwA3pKtak/wCMXpBuEhIBJIje+F6+UYLFPF46paUdorS3z5y2T7l62co46wnEOZ4COAyulqjPectUY7J7RV2nu930tZHs1w95gcMHDrwk4RymwnjJx+So8t+i59VCmkOVGbWdT8yuzXNaySAb6UhKeSRHXfwuyD99/LL5HzmvB3xd/p1/HD+omv8APY5E/syc/kab/qofhdkH77+WXyJ/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/Tr+OH9Qfnscif2ZOfyNN/1UPwuyD99/LL5D8XfFv8Ap1/HD+oPz2ORP7MnP5Gm/wCqh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/AE6/jh/UH57HIn9mTn8jTf8AVQ/C7IP338svkPxd8W/6dfxw/qD89jkT+zJz+Rpv+qh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/Tr+OH9Qfnscif2ZOfyNN/1UPwuyD99/LL5D8XfFv8Ap1/HD+oPz2ORP7MnP5Gm/wCqh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/AE6/jh/UH57HIn9mTn8jTf8AVQ/C7IP338svkPxd8W/6dfxw/qD89jkT+zJz+Rpv+qh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/Tr+OH9Qfnscif2ZOfyNN/1UPwuyD99/LL5D8XfFv8Ap1/HD+oPz2ORP7MnP5Gm/wCqh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/AE6/jh/UH57HIn9mTn8jTf8AVQ/C7IP338svkPxd8W/6dfxw/qD89jkT+zJz+Rpv+qh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+oPz2ORP7MnP5Gm/6qH4XZB++/ll8h+Lvi3/Tr+OH9Qfnscif2ZOfyNN/1UPwuyD99/LL5D8XfFv8Ap1/HD+oPz2ORP7MnP5Gm/wCqh+F2Qfvv5ZfIfi74t/06/jh/UH57HIn9mTn8jTf9VD8Lsg/ffyy+Q/F3xb/p1/HD+op+exyJ/Zk5/I03/VQ/C7IP338svkPxd8W/6dfxw/qPJb5RDCGAM4swcF57cPeIQ9nRRphmUqckqVelBUZVBJZf1vIS32jJukhShrbXbfQBGPX4m4axVCVGtUvGSs1plyfqMzB8DcbYDF08Th6GmcGmnrp7Nf8AIaFGmqhO4Tps3VqYaLVHZdKpuQLyXfR3Ld5AWklKgDexB5Wj53rwpU68oUpaop7OzV10dnuj7KwlStWw0KleHi5tLVG6el9VdbPfk+wUoxzMCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACIJCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACJICACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAKgXUAOZMAPbLPhx4oM18hsL5jYYOWcvQK/JCckWqjVag3MIbKlJAcSllSQru9FEecdwp8D4KpTU1Vlv9X5HCsd4SsHgMXPDVaTcoOzstv+w+vzl3F9+v5Tfy1U/93i7+AmD/AHsv5fkYH41cu/dS9i/qKfnLuL79fym/lqp/7vD8BMH+9l/L8h+NXLv3UvYv6iC8YYRzTyn4m5TLTNBrC65+bwz8+Sz+GpqZeQGzMFgJUXkoIN0qNgnlbfpGn8QcO4fJsLGrTm5Nytvbsb6Jdh0PhriinxJGU6UNMY3W+zurel7bmSOdHQQgAgC7CGFMys3c+JjLvKCnUadq9NppqFfqNfmXmZCntqIDLSltJUrtXDeyQk7C5sASOg8P8Nf4tTlVrNxj0tbe3N7326L03Of8ScV4PhyMXVWpvot38V3v1E3fnL+L79fym/lqpf7vG6/gJg/3sv5fkc7/ABq5d+6l7F/UV/OXcX36/lN/LVT/AN3iPwEwf72X8vyH41cu/dS9i/qD85dxffr+U38tVP8A3eH4CYP97L+X5EfjWy791L2L+o51ziwdnjknmRhLB+J38vKxifECVusU6hT89MOykuiwVMzGttAbaubA3JUUqsNjHk5hwrlWWYeVevWlZdPJu/Qtub6G4ZHxhLiGbjhKLSXWSsvdJ8ub7Nu0V0a+xR2hSpzSNZSCATbewPIRyF2vsdV36l0QCOsV4+mcPZjUPCtLwhUcW1mpyL840zIzkuwENsqCVkl5SR1B5x72Dy2GJwtTE1a0acINRbak92rrzUzU8yzqpgcfSwVHDyrVKkZSSjKEbKLs/OaQ+6a9MztHkX5yQdpM4+2hT0k+4la5dauaFKQSkkcrpJHhHiVlCnOSjLUlfdXV/Sk9/abNQlUq0oSqQcJNK8W03Fvo2tnb0bEfy+ZtNmMicVY+TSpxNPoT060/LFae0dMqvQspPIajyvHuzymrDMaWCc1qqKLT3stSur9xq0OIKE8mxGaKnLTRc01td+LdnZ8t+g/6fNoqNBkKg2hTbc1KtvoQs7pC0BYB9gMeJVg6VWVN/qtr2OxtFCqq9CFVbKST9quQPPcRGHGMeSUhTcM1+vYfeZmnV12RkSplSZYgOuMoPefaQSdbgta2wVvbdKfC+KlhpTqVYQmnFaG9/K5KT5Rk+i3v1scyrcdYCGNjSo0KlSk1N+MjHa0POcVznGO+qSta2yZL/wCbHCYo9Gn3cS0uWk6u2lyluTM82z6WlQukthZBVt5eXONV+g41znBU5Nwvqsm7W7bXN9/xXLFSpVXXgo1UnBuSWpPla9r/AHRvzddoVPqCZSoVunSE2oApYmp9ppxQPIhKlAm/TbeLMMNiKsdUISa7Um17UjKq4zB0J6KtWMZdjlFP2N3KzNbosnXpWlTlZkJSqTIJl5N+dbQ87b71BOo+4Qhh8RUpupCDcVzaTaXe+RNTGYSjXjQqVIxnLlFySb7k3dmvM4nw1J1xqmTeI6VK1J17sG5R2otJeU5a+jQVatVt7WvFcMJi6lN1IU5OKV7qLtbtva1izPMcvpVlRnWgpt2Sco3v2Wve/oMs3X6DIYhlKRPVynyVWmt5WSmJ1tt979ygqCj7hv0imGGxNWk6sINxjzaTaXe+RXVxuCoV40KtWMZy5RckpPuTd2XrrdEbrvzW5Wqe3VNQT6EueaD+oi4HZlWq9ulopWHrul41Qents7e21it4zCRreIdWKny06o6v4b39xRiu0OZxE9R5at0+Yq7KSp2RanW1vtgEglTYVqFrG9xtaJlhsRCkqsoNQfJ2dn6+RTDG4OpXeHhVi6i5xUk5LvV7irGMZwQAj1E4inMSYRwtg6TlKhi7E1fl6RSmJ5a0sBbpJUtwo7wQhIKiRew3seUbLkeVxzbHeIm2opXbXPsXaa/nWaU8nwEsXPdROiPzl/F70mMpiPH56qf+7x1D8BMH+9l/L8jjf41cu/dS9i/qK/nLuL79fym/lqp/7vD8BMH+9l/L8h+NXLv3UvYv6g/OXcX36/lN/LVT/wB3h+AmD/ey/l+Q/Grl37qXsX9RQ8F/F8Ek9vlN/LVT/wB3h+AmD/ey/l+Q/Grl37qXsX9Rz8ZXFWHM2Mc5e47l6dK4ywrU0Sk+mkrdVKuocaS6062XUpWUqCjuUi9uUc3z/J1k+KjTg24yXN9q58reg63kGdUs9wCxVNWT6fdv0ijGpG0hABABABAGhTKLmBjriQwdlhly1QPn6uyU7MpexE++1LoEqgLUNTKVKBKSbd0725RvPDuR0M5dRVJOLja1rdb87pml8R8QQ4ewyxFSOqPW3Pmltuu06A/OXcX36/lN/LVT/wB3jfPwEwf72X8vyOX/AI1cu/dS9i/qD85dxffr+U38tVP/AHeH4CYP97L+X5D8auXfupexf1B+cu4vv1/Kb+Wqn/u8PwEwf72X8vyH41cu/dS9i/qD85dxffr+U38tVP8A3eH4CYP97L+X5D8auXfupexf1B+cu4vv1/Kb+Wqn/u8PwEwf72X8vyH41cu/dS9i/qD85dxffr+U38tVP/d4fgJg/wB7L+X5D8auXfupexf1B+cu4vv1/Kb+Wqn/ALvD8BMH+9l/L8h+NXLv3UvYv6g/OXcX36/lN/LVT/3eH4CYP97L+X5D8auXfupexf1B+cu4vv1/Kb+Wqn/u8PwEwf72X8vyH41cu/dS9i/qD85dxffr+U38tVP/AHeH4CYP97L+X5D8auXfupexf1B+cu4vv1/Kb+Wqn/u8PwEwf72X8vyH41cu/dS9i/qIOxrgrNjKLiOpGXuaCMKOTNTw67WJV7DM1MvJShD4Z0rLyEWN7mwB2tv0jUeIOHMNk+FjVpzlJtpb2tbfsS7DoHDXFVLiSU3Sg4qPbs77el9oRzg6IEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAXI/TU+0RDDPWvgl+1UZH/waR/OOR9i4X9Gh3I/PXiX/AD7E/XZ1PGYaqEAeNHHB9tqwr/mmT/tN2OUcdfoFP6y+Ej6l8FP6JW+s/hEgKODH0eEAIWIKtM0ulSzVLp7laxHUptuQoVKYGp2fnHVaWmkjzUQT4AGPYyvLquZ4yNCHLm32L59EeZmGOo5dhJYiq7KKfP7+09nOFnIKVyA4ZpShTrzdVx3V3fnPGFYAuZyecHeSlXMtND7GgeAKrAqMfVWEwtPCUI0qaskvv7D4Gz/OK2d5jLETfk/qr0dve+b9nQ6VjONXCAIQ4gM88L5AcOtTxziLXOzRV6JRKQwCX6rPLB7GWRYEjURdSvuUgnwBx61aFCm5zeyPbynK8Rm+NjhqK5832Lq/l2s8QmHMT4jzAr+Y2YlQ+esxcRvdtU5g2KJNsfpcmx96y0myQBzIvHzJn2czzbFPS/yceXp9L+zsXez7vyHJcNkmBjQpxs7b/wDvvfpFiNSNqCAOcc2KQJniPwNVqjQcVVXD0tQp5mZewo1Ml9p1biS2kqYUlQBsSRexHjG+ZLXcMrr06dSnGbnBpVNNmknfaSaOS8TYXxmfYWvVpVp0o06iboqepNyVk3Bp+q+5K+C68mcmpeiy2GcRUilyNOlnpaerzC0LfClFJbUXCV9qjTdWok2Nz0vrWYYZwi60qsJSlKSag07bXurbWd9rbdDd8pxqqyWHhQqwhCMWpVE1e7tZ6m3qVt7u/Xv5vRlQ/N8J+Zk3NU7ErWKnp+ruSFNaqU20iYBeu0RKpUEOBY3HdOrzjfnnMYZzhoRlTdNRp3lpg2tt/Laurd+xyRcNTq8NY6pOFVV3Ks4wUqiT8ryfyadpX7nq9J0VhqcmqnQJ3Cs7QqpRm6fRpOUNRmWwhqaU7KAL7E8yWz3VX+6EaHi6cKNSOJhUjLVKTsuatLbV9bmvQdXy+rUxFCWBqUp01CEI6mrKWqnZ6fqvZ+k5glKVmnhPH+XGGv73qa5UKDhuq0qnz0tONCnzrb2yHnFK/StIPfQuyldBvHRp1snxuGxOI+kaI1J05NNPXFrml236NbLryOM08NxJluNwWD+h+MlRpVqcZKS8XJS5Sk35tl50XZvpzEqqZSYgwrOJpFXZrNZosxg+Wpzc3QcJS9cUhxGtUwwO1suXu44VIWm1xbcadsqjnWGxi8bScYzVSUrTqSp7O2mW20tlZp3tv2mDieGMdl0lQrqdSnKjGClToxrNNXc4+VvDyneLVr7b3SMOLxJ1KczJm/zG4hr6qVQKdQabVHcOKmOzekFIcm31u7hhYSCk2N+dzFWB10o4aHjoQ1znUlFTttUuoRS21JvdbFvNVSxE8bP6NVqeKp0qUZuk5WlSs6knLfQ0tnv3jhxDht+rSOaksctqlizEmM6kiqYSxM1IJU2xLPoQtjXMqN5bsLG6Li97ct4wMNi40JYSX0mNOnQi4VKbe7lFtStFefr6P18z1sbgKmJhj4fQZVq2LmqlGqo7KMknC9R/m/F9Vtfly3Emo0ZmoV3P3D7uXVQx3jOoVJuQp9dl6Wh1tl/0dAKlvH9T2X9lvtq5XjKpV5UqeArrExo0YxcpQcmm46nyj+tt5PoMCthYV62bYWWClicROShGooJpS0LdyfmWflX68ri1iPB9YYls1KDV8tqljLF+IPRU4cxDLyKZhlkJl220kzSt5fslpUog2vy84xMLjqMnha1LExpUqWrXBys3eTfmLztSfqPSx+VYqnHH4bEYKVfEV9HiqqipRVoKK/KPzNDTfS/vE3FuBMUzuetbMth+qVWp/mkpU1Kq/M02qSnUMS8ul1xdUVZxlF0Od1JsSORJMZGCzHBwy6GqpGMdFRPy3qjqlKyVJbSe63aMLM8mzKtndXRRnOfjaUl+SWiSjGGpuu7SirqWye7XJtilRMP4vneLTCuI6nhCo0eelMYTpqJkcMsylNZlXEuBLnpSE9pMlw7qWs6d7WFxfHxGJwMMlq0KdaMlKlHTeo5TclbbS3aGnolv7zNweCzWrxRQxdbDSpyhWnq00owpqLUrPWlqqaubk3b3X7RHqj2RyQ+hVyKwJJr4PcJnG/ypLVaXpcpeXOF3ZxQUAoCfqBLDQseoZS6q45beNj3DgbB6aE8TJec9u5bfG588+FHMfF4KGDi/Oe/xf2e09qB6ojsB8olYAIADuIA8fOOrCTeEOP3AOP5ZotyGPKA7Raiu3d9NkSHZdRP3ymnCj/5YjlvGuC8dgFXjzg7+rk/in6j6Y8FmZW8ZgpP0r1/3T9pzdHAT6cCACACACAJJ4aftwOSv7w17+jJjsPAn5yt/x+DOH+E//JF6v+0T3Ljt58dhABABABABABABABABABAHjvx1fbPcu/8ANlM/7QMco46/QIfWX2n074KfMrd7+ETnOODH0uEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAXI/TU+0RDDPWvgl+1UZH/waR/OOR9i4X9Gh3I/PbiX/PsT9dnU8ZhqgQB40ccH22rCv+aZP+03Y5Rx1+gU/rL4SPqXwU/olb6z+ESAo4MfR5atbbTK3XVpabQkqWtZsEgC5JPQAbxKTk7LdshtJXZ1VwJZNPY9zSXxL4qlFow9T+3p+W8k+gjtAbtzNTI8Vd5pvntrO1kk/SXDOTLLcJrmvLlu+/s7ly77s+TPCLxN9Lrf4dh35K874pd75v0W9J62AACw5Rvp8/hADexZivDuBsuKzi7FlXl6Fhykyq5qoT80vS2w2kbk9SeQAG5JAAJIEUykoq75F+hRq4mrGlSV5S2SPBbMDMuvcRfEic3cRyr1LwxItKlcv6A+QTIyirapxy3+PfPeN/VSQkEgJMcF4sz76VUeCoPyV5z/AP5+fs7T7X4L4Yp5JglUqb1Jbt/b7Nl7epqxys6sEAEAEAHSACACAK3Oki5seYvAFIATUUektU2pSbdNlm5SoOOuzzKWgETK3RZ1Sx90VjZRPOMh16znGbk7xsk78kuVu7oYkcLho0501BKNRtyVtpOXnN9t+vabkvLsStPYlJZlEvKsNJaZabTZLaEgJSkDoAAAB5RZlKU5OUndvdvtZfhThSgoQVopJJLkktkjQp9EpNKqlYnadItyk1VZr0qouIKiZh3SE61XJsbADawi/VxFatCEKkrqCtH0LnYxqGDw2GqVKlKNpVHqk9/KdrXfq7BVjGM0pYQIsivWBIQBQlIF1nSgbqPgOphv0B6HfJz4Q9C4QcR5nzcqtip5hYlmai2pxIBMjLqMtKpHXTZDihf7/YW3P1fkuEWCy6nRXRL+/vufDfHuY/T8+mlyht63v8Lew9B42E5eUJA5wAAgi4gCsAcV8fWBnsV/J14kxBTZZUxiHBE7L4opmhF1XlV/ZxfnYy63r28OR5R5eY4eGLwU6Uls017TeuD8wll2fUpp2UnZ/Z70jy2k5yXqNIlKhJrDkpNMIfYUORQtIUn6CI+R6lOVGpKnPnFtPvWx98RkpxUo8mbMWyoIAIAIAknhp+3A5K/vDXv6MmOw8CfnK3/H4M4f4T/8kXq/7RPcuO3nx2EAEAFx4wAXHjABceMAFx4wAXHjABABABAHjvx1fbPcu/8ANlM/7QMco46/QIfWX2n074KfMrd7+ETnOODH0uEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAXI/TU+0RDDPWvgl+1UZH/waR/OOR9i4X9Gh3I/PbiX/PsT9dnU8ZhqgQB40ccH22rCv+aZP+03Y5Rx1+gU/rL4SPqXwU/olb6z+ESAo4MfR5tYJyyqvEFxL0jJqkPvSWHw2mo48qjAI9CpoVtLpVyD0woaEjwuqxAIjp/COTvFYj6XVXkx83v6v1cl6e45dxtxFDJMucYO9SWyXf8Ae79G3U99aFRKThvBtKw/QqezSqLTZRuUkJOXTpbl2W0hCG0joAkAR3+KUVZHxDUqTrVHUm7ybu32tirFRaLVKCE3UbCAPE3itz1VxE50zGXGFZ4PZG4TqANUnJdw9niipt37iFpNlyrJI8lLBO40Ecu4qz/6FT+jYd/lJe5dv2L29D6i8H/CPiorMMXHynyT6Ls7319G3VkPAACwAA6ACwEcAPpIrABABABABABAFLjxHxgAuPEQBWACACACACACACACAGhjpyory5mKTRQV1+uTDNGpSBzXMTbgZQB594n3RsWRYX6ZmlKFtk7v1b/Gx4ubYqODy6rWk7WT+/sufQhl1g2n5eZD4OwLS2225CgUaWpzPZJKUqDLSUFViSdyCdyecfVcVpil2H54YqvLFYmdaXOTb9rHnFZiHDXyieMpzCXyX+LZSlFXz3iSoSVEpwaXZ0rdeDitAG5UEMrtbcc+kYGNqKnh5Sbsu3s9JvHCOD+mZ5Tja6jd+63xZ0nkjjtnM3hGy4x+y6HlV3D0rOPkEGzymgHU7E7hwLB63G+8ZVOWumpdprWY4Z4PHVaD/Vk16unuJSi6eYJ1XpkjWsLVKj1NhM1TZ+WclZthfquNOJKFpPkUqIiGk1ZlcJypzU47Nbr1HzsYeo09g+fxVlzVAsVHBeIpygr7Q3UtplwlhfmFNKQQeoEfMPE+E+iZvO3Ke/r5P4X9Z+gvDWPjmOTUqyd7r+45I042wIAIAIAknhp+3A5K/vDXv6MmOw8CfnK3/H4M4f4T/wDJF6v+0T3Ljt58dhADGzOrFRw9w4Y/r1ImPRKrTcNz85Jv6Er7N1qWcWhWlQINlJBsQQbbxbqNxg2uwzMJTjVxdOnPk5JPubR4g4b4k+L6vZe0Ktq4h1SyqhT2plTP5h6WrQVpBtfshf22EcbxXGtfC4qdDxKeltX1c7f8T6/oeDrh2tQjUcLaknzl/ULX9/7i8/8AvHL/APoSl/1cYn4eV/3C/i//ACZH4tuHP2PfL+oP7/3F5/8AeOX/APQlL/q4fh5X/cL+L/8AI/Ftw5+x75f1B/f+4vP/ALxy/wD6Epf9XD8PK/7hfxf/AJH4tuHP2PfL+osc4gOLxuXcc/PGrVoQpVvzCUvewv8ArflFUeO8Q5JeIX8X/wCSl+DbhxJvR75f1Hrvw54sr+O+BPKTGWKp/wCdMR1rCklPVKb7FDXbPONBS16EAJTcnkkAeUdsptypps+R82oUsNmdajSVoxk0l6L+kmmLp4wQB478dX2z3Lv/ADZTP+0DHKOOv0CH1l9p9O+CnzK3e/hE5zjgx9LhABABABABABABABABABABABABABABABABABAFyP01PtEQwz1r4JftVGR/8GkfzjkfYuF/RodyPz24l/z7E/XZ1PGYaoEAeNHHB9tqwr/mmT/tN2OUcdfoFP6y+Ej6l8FP6JW+s/hE5hxNXjQMNB+Xk3KrV5p9EnSKawkqdn5t1WlplAG5KlEbDpeOOZbl9XMsZGhDl1fYur7+i9J3/HYylgMNKvUdlH7/APvoPZThOyFTkVwzS8lWCiczGxA6KrjSoBevtp1af0lCv1plJ7NA5bKP3UfVOBwlLBYaNGmrJI+B+I86q55mc8RJ3ito93b3v5LodQx6JqYQB5lccHEXUW5x7hzysrDsji6pSyXcZ12UUUmg05f+JQtPqzL42A5pQq+xUCNTz3OKWVYVye8nsl2v78+xemx2XgbhWea4pYuvH8nHlfq+3uXTtfoTOD6TSqfQ8NydIpUsmUp8q0G2W0gCwHU+JPMnqSY+Y69eria0qtV3lL7+xdD7Kp04UaahBWSFGMcuhABABAGpPT8jTKU9PVKcYp8k0LuzEw6EIR7Sfqi9SpVa81TpRcpPolconOFOOqbsjYwRh7NnN5aTk3lXVsV0pRI/NLVSKXRrXtqQ+9YvAG9w2CfKOh4Dg3H4lKVeWhdi3fyXvOc5vxtkuVXjKalLs6+xb+2x1XhvgDzprUuH8c51UHBijpV6DhPDhnyncEpL80pN9iobItsD4iN8w/BWV0l+UvJ+lv7LHI8Z4VazlbC0dvTZf1ErUz5OjCTNQecrGeGZVTYUnuNMT0lK6FXve6ZY3FtrWEe3HhfJI86KfqNVn4S+IX5mle1/ajFVPk6MNrqBeoOemYtLQGrNtTr8jPIDlj3lapdOpPLu7cue+1M+FskmrKil3fPmVUvCZxBFp1NL9q+ZC+KuBbiDwvT3ZnBWYuF80kNkn0Gu0xdGm3E2GyXWlLaKib+sEjlvzjX8VwRl9S7otwfft77m5YDwqJy04ulb0rf4WfuZyviaaxFlzjNjDeb2C6tlZWnzaVVWEpckJw/9xONksuey4I6xzjMeFszwPlRXjI+jn7Pk2doyrijKM4hehUV/v6160hX5gEcjyjSDcwgAgAgAgAgB+8PmD2syPlRcr6HMMGYpOEJSYxfUklBKO0asxJg9P01erf72Ov8AA2D1VKmJfoivVu/e0cS8JWZPCZP4iL3nt7f7JnusBZIB5x3E+OCsAeVXyheIRVM/8g8vW9K2ZI1DFFRQVA91pCZaXum/Ircc3I3tsQQY55xjifEZTKC2c9l6/wC1z6A8FuC8bmFTEvlFW+35EnfJyYnMxwbYmy5mXlKm8C4wnKcy2tRJTKPqE3LkXPKzrgGwHd2HU7HkmKWMy2nV7Uv7+80/j7AfQs/m1ykvht8LHoPGwHLw5ixgDxZ4xcIO4I+VCVX220tUTMbDDcylQTpBqNPsy6PNRYU0q/M+6OQccYPVh4YlLeL9z2+Nj6s8FuZeMwc8E3vH4c19pCMcOPogIAIAIAknhp+3A5K/vDXv6MmOw8CfnK3/AB+DOH+E/wDyRer/ALRPcuO3nx2EARpnP/1QM1P4H1P+huxZq/m33M9HAfp1H60fijwFy7/wBYJ/eOW/mxHyXmv+aV/rP4n6LYL9CpfVQ8Y8kzQgAgDE/wDqCY/yK/8AVMVw89d6+JTLzWex3CL9rEyF/gNTv5hMfY9L81HuPztz3/OMR9d/E6Li8a+EAeO/HV9s9y7/AM2Uz/tAxyjjr9Ah9ZfafTvgp8yt3v4ROc44MfS4QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBcj9NT7REMM9a+CX7VRkf/BpH845H2Lhf0aHcj89uJf8APsT9dnU8ZhqgQB4z8cJA+VnwspRCUjKVJJJsAPnN7eOUcdX+g00v2l8JH1N4Kf0St9Z/CAv8DWTDmZOcR4jsVyTgwjRHXZLLiTmG7Jm3t0TFUIPOxu20fEKPNIMerwvkqy7CqdReXLd/L1fG7Ne8IvE/0mr/AIdhn5K875evm/RZdWevNrDaOhHz0EAcm8WnEezkJkpKytAYarGamJnFyOEaSs7Fy1lzbuxAZZ1BSr2CjZPUkedjsZRwOGlWqOyX3+/a9jc+G8hr59j1SivIVtT+z19vRXZ4/wBCpE1TmahPVeqPYgxRVpxc/XqzNG71Qm3DqW4o+FyQkdBHy1mmZVs0xbr1OXRdi+b5v0n3Zl2X0MtwscPRVkvv7F0F6PFPVCACACAEOsVpdOnKRTKfS5zEWJaxOJk6JRKc32k1UH1EAIQOgFwSo7AR7WWZZiM1xHiqWyXN9F/d9F8EeVmGY4XLMM6+Idkjv/h94E5VD9JzF4kkMYuxmkiYp+DNSXaLQTe6UrQLpm3gLXUq7YN7BdgqPozKcjweV07Qj5XV82+9/ZyR8g8TcdY7NKjo4WWmn2rZvu7O/wA7u5HpWxLsy0mzLsNIZYaQENtoSEpQkCwAA2AA6CNqOPttu7M0CAgAgAgBuYqwjhjHGBZ/DOL6BIYlw/OoKJqn1KVS+y4PNKgRcdCNwdwQYpcVJWZkUa9bDVVVoycZLqtjx/4heFCvcPVMqGP8qfnHGOTbH2SrYWdWqYn8NN3uqYlXDdT8sn7ptXeQBe6hqUnmmf8AC9DGxdfD+TU7e3v+fNdbo+kuEOP5znHB5hzeyfb8n6OT6WfOAqfUJKq0OUqdOmETchNNB2Xeb9VaTyIjgNWlUoVXSqK0o7NH0tTnCrBTg7p8jci0XAgAgCoBKgBzOwiHsrg7h+Tmwmqaw/m/nBNMJJxDiEUajPlV9UjT0lBKdtkqeW57Sjyj6g4Zwf0PKqcWt2rvve7+Nj408JOZfS85VCL2gvj/AGXvPTKNxOLAdgTAHhZxDYl/Nx8qhm5VkuF6n4WlZLClPJJISptHpE0B4fZXbG1uW4POOGcc4rVVp4dPtb9Wy+LPsjwaYH6Nkvjmt5u/39ViR+B3E6cLfKQ4zwi+72EjjrCLU9KpUdnZ2nuFK0gffFl0qPLZPXp7vA+L8ZgZUG94t+x7/a/Yar4VMA3TpYtLls/Xt8Uj2Mjqx8whAHAHyimDJip8GFIzJpzal1PLzEcvWHNCAVKknD6NNp5XtocSs26N78tvAznBxxuX1KT6p/f22OmcC5l/h+fQu9p7fb816zzpCkLQFtqC2lDUhQ5KSdwfhHydZrZ8z7nVnuisCQgAgCSeGn7cDkr+8Ne/oyY7DwJ+crf8fgzh/hP/AMkXq/7RPcuO3nx2EARpnP8A9UDNT+B9T/obsWav5t9zPRwH6dR+tH4o8Bcu/wDAFgn945b+bEfJea/5pX+s/ifotgv0Kl9VDxjyTNCACAMT/wCoJj/Ir/1TFcPPXeviUy81nsdwi/axMhf4DU7+YTH2PS/NR7j87c9/zjEfXfxOi4vGvhAHjvx1fbPcu/8ANlM/7QMco46/QIfWX2n074KfMrd7+ETnOODH0uEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAXI/TU+0RDDPWvgl+1UZH/waR/OOR9i4X9Gh3I/PbiX/PsT9dnU8ZhqgQB5p8VPCZmTn58oNgrENInpCiZZu4TZoWKqiqd0zyGBOuzDzbDWk3UtBSgKJsNZvyjxMbgIY2rTlPlB6vWk19u3pOp8O8UUsiyevRjd1Zt27N0lz9W56I4cw7RcJYEpGGcOU5mkUGlyjcpT5KXTZuXZbSEoQnyAA57nmd49pJRVkcyq1alerKpUd5Sd2/SLcSWSL84s2sH5JZAV7MLG0+mUpFOaPZMBYD08+QeylmUn1nXCLAdNybBJItznGnHVI9LAYGvmWLjhqKu37EurfoR4W1Cv4rzNztr+cWYqA3i+ujs5GnpXqbodOB+wyTVtjZNitdgVKJJ3Jj5t4lzuWZ4l0qT/ACcX7X29y5L2n3Vwxw/QyLL404rymt3135+t9ezZdDejRTeAgAgAgDSqVRk6RQJ2qVF9MtISjKnn3VHZKQN/f0HmRF+jRqYirGlTV5Sdl9/j6C3UqQpQc5uyR33wK8Pbkjh5jiOzEkHBj3EsoTheQfUdNApDiR2YSnkHn099auYSoJ2uq/1DkeVUcswkYRW/V9r6v19OxWR8V8ccTVc3x0sNTf5KD9rXTuXvd32HpKBZIEbQcjKwAm1esUug4dnKxWqjK0ikybSnZudnZhLLLCBzWtaiEpA8SbRDaXMrhCdWahBXb6LdnF9W+UK4bpLEjtNotZr+N+yWpDs3hrC81OSoWkm6Uu6UpXsLhSNSSOseVWzPAYd2q1FHvZvuF4L4hxUFONK1+1/K9vXZj3yx40eHzNXGsthei4zXQsVzBAlqNianu0qZmCTZIa7YBDilcwhCiqx5Rk0MXhsRG9KaZ5mYcNZ1lkNdek9Pat/aua72rHVYII2jNNSCALHG0usqbWApChZQIuCPCA5M8R+J7JNrh64m5GsYYlDK5O49nnBLy6EaWMPVcjWqXRYBKGHxdTaeiwsDYCOQcXZJGpReNoryo87Lmv7c+667D6v8HfFE8ZT/AMPxUryjyb6rt+x+mz6siaOHH0KEAEANfGtaOHcqK/V27mZZk1JlUpFyt5fcaSPMrUmPUy3DPGY+lRts2r9y3fuRhYyssPhZ1X0X/h7p8O+XCMpeCXLLL82VN0igsInlBATrmVjtX1e91a+e/jH1tSjopqPYfnhmuLeOzGriP2m7d3Je4mmLx443sW4jkMH5YYixZVFhFMo1MfqE2orCbNstqcVudhsk84pk1GLbL9ClKvWjSjzk0l63Y+d7BMxP1TBTmKawSut4nqEzXqgtRJUXZt1TtiTzskoHTlHyxxDini82qy6R8lern77n6G5JhI4HK6VGPRIcMpit3LXiCymzXYUGkYWxUwak4VED5vmj6NNgkA7aHATseUe1wfjPo2aeLb2mvet/hc8DjHLlmWRVaaV2lt9nvSPodacQ7LpcbWlxtQulSVXCh0IPW4j6PPgt3TszJAgaeO8J0/HmS2K8E1UXptepEzTZnbcIfaU2SPMar+6KJx1Rce0ycNXlhsRCtHnFp+x3PnpwQzU6dgdWGq6NOIcNT0xQaqg3ul+UdLJvfxSlJv5x8r5/hHg82qQtZSepevn77n6G5NjIY7LKVeLvdL7+yw7o1o94IAIAknhp+3A5K/vDXv6MmOw8CfnK3/H4M4f4T/8AJF6v+0T3Ljt58dhAEaZz/wDVAzU/gfU/6G7Fmr+bfcz0cB+nUfrR+KPAXLv/AABYJ/eOW/mxHyXmv+aV/rP4n6LYL9CpfVQ8Y8kzQgAgDE/+oJj/ACK/9UxXDz13r4lMvNZ7HcIv2sTIX+A1O/mEx9j0vzUe4/O3Pf8AOMR9d/E6Li8a+EAeO/HV9s9y7/zZTP8AtAxyjjr9Ah9ZfafTvgp8yt3v4ROc44MfS4QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBcj9NT7REMM9a+CX7VRkf8AwaR/OOR9i4X9Gh3I/PbiX/PsT9dnU8ZhqgQAQAQAQAy8c5dYFzMwd+Z/MDCVKxjRQ6HUydWkkTDaHACkOJCh3VAEgKTYi/OKZRjNWkrmXhsVicHV8Zh5uEu1Ox59ZofJ506Rps7WuHPFc3gerIKnW8J1uaXO0KbOx7NJXqdlid7KBWBsLAbjVMy4ey7MYvXC0u1bP2/O6Ot5J4Q80wE1DF+XDt6+zk/VY4JTPVqkZkVLAWPsNzeBcxKaCqdok8LhxANu2l3R3X2jY2WgkW6nnHBs4yLF5RO8vKp9JfY+zv5P3H1Tk+eYHOsOquHknf7/AHT3XVC3GqmyhABAChgTL/8AvzcaGV+U7qEu0F6cOIMUoWCUrpsipKiyoDo86UN++Om8GYD6RjJYiS2hsu98/dt6zlvHmcPKslkoO0p7L7PtfqPoAaQlthKEIDaUiyUpFgB0Aj6DPh3mZIAoTYQB4T8R2cE/xK8RlXpbU65/eLwhU3JGlUxl09hiOeZUUuzz1gNbSVdxtBuLAq+6VHIOK+IKmGl9EwztJrd9i+b9y36o+tuAuE6OFwqxuKjecvd6PV17Xt0GCy03LSbcvLNpl5dCQlDTSQhCQOQCRsI4hKTnJyk7t9Xu/ad9SUVZchLrlBpOJKOZGtSaJ1i+ptSjZxlQ3C21jdCgdwQYy8Ji8RgqqqUJaX7n3rr97FivQo4mm4VY3TPRPgVz8r2IpWt5DZj1V2r41wtKJnKDWpx8rfrlIUrSlbilElbzKiELPVJSdyCT9NZFmsM0wcanXqux9V9+jR8XcdcNf4LjvH0V+Tm/Un9l+zo79LHoxG0nJAgCEuIrKmWzp4Nsd5euJQKhUKcpykPqRcy0819llnU7ixDiU9eRI6xj16arUnB9T2spx8stzGniYvzWr93U8MsHVt/EOW1Lqc40qXqRQWagytOlTUy0otvJI6WWk7ecfJuZ4P6Bj6lDont3PdfI/QvA4mOLwkKy6r39RzR5JnhACrl7hL++Xx4ZKZdOS5m6U5XDX663fumTp47YJX+1W72afPlHTuCsGq2OnXktoKy73u/cvecs4/zL/D8hmou0p7fZ9t/Ue/qL9mLix6iPoI+Hi6AOGvlCMYLofyfE/g+RfS3WMeVmUw3LJAuvsnXO0mVAeTLSwT01R42a4qOEwNSrLon8zoHBmXvMM/pRtdR3+xfE8zW2m2JdthlOhltAQ2PBKRYfQBHyS5SnJylze/tPvNJRVlyQkYjozWIcA1qhOgFE/JOMC/RSk90+5Wk+6MvCV3hcVTrr9Vp+rr7ixXpKvRlTfVNHs3wiZjv5pfJ35ZYnqD6Xq83SxTK0LkrTOSijLO677hRLYUf3XXnH13h6irUIzTvdH57Z/gnl+b1qFrK913Pf3cvUdJxkmuFCNSSDAHh3xM4NVl18qLjxhttbdGx7TWMUU4k3T6Sj9DTqAfHUlDhHOyx0tHEuOcHZ08VFeh+vl70/afX/AIMszWJyp4WXnQf39z9xGEccO6hABAEk8NP24HJX94a9/Rkx2HgT85W/4/BnD/Cf/ki9X/aJ7lx28+OwgCNM5/8AqgZqfwPqf9DdizV/NvuZ6OA/TqP1o/FHgLl3/gCwT+8ct/NiPkvNf80r/WfxP0WwX6FS+qh4x5JmhABAGJ/9QTH+RX/qmK4eeu9fEpl5rPY7hF+1iZC/wGp38wmPsel+aj3H5257/nGI+u/idFxeNfCAPHfjq+2e5d/5spn/AGgY5Rx1+gQ+svtPp3wU+ZW738InOccGPpcIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAuR+mp9oiGGetfBL9qoyP/AINI/nHI+xcL+jQ7kfntxL/n2J+uzqeMw1QIAt1JvzHxgA1pvzv7IAqCFJuDcQBWACAOX+KHhqoHENk0mXadaw/mRRtUzhHEyUkOSExz7NZTuphy2laN+YUBcb4WKwtLF0ZUqiTTTW/pNryHPcTkeMVWm3ofnL7V6V09j2PGug1Gqvqq9FxNTTQ8ZUGoO0zENMVsZaaaNlW/aK9ZJ5EHblHy5nOVzyrGuj+q94v0dj9K+T6n3flWZUc1wUcTTd7rp9+v9hwRr57QdIA67+T3w4KlxI585hPJ1Jp7dOwvT3BuAEoM3Mi9+epbNwRt0PMD6L4Nw6pZTGfWV37X8kj5O8KeNdTH0sMntHf7F9p6sx0U+fAgDnriux9M5Z/J35s4vkHgzVpegOy1NVcahNTJEuyUgkXIW6CADfbYHlFitNU6Tk+h7+R4T6bm1Gg1dOSv3Ld/A8VMM0VnDmXlFoTCAhMjJtsqsPWWEgrUfMqKifbHyJjcRLF4upXl+s2/V091j9DMPSVChGmui/8ARcjBMkIA3sC4ndy846MiswGHAw01ilug1VZJ0mSqILCwoAG4SsoUBY7gcucdL4Lxbo5hKi3tJX9a2+D9xy/j3L447IKjtvFXXq3+KPoFT6u+5j6FPhsrAFFC6fZuIA8A8wsNpwRx7cQWDmGVsyDOLRV5FJaKEJaqLCZkpRfmkLKxcbbG3WPnvjbDqlmMKq/WT9z/ALn3HwBjJYvh6nqd9O3s2+wSI5mdRCAOt/k9sJmucQ+dWbL2h2TpyZbB9IXpBIU2BMzhB6d9TQ87eUfRvB+DeGyqM5Kznv7eXusfJvhRzHxuOp4NPaO7+C99z1djoZ8+hAHjpx+44TUeOXLfCT7VSVQcIUKYqkwuXpUzMsrn5whtpP2JtXeQygquTYdp47xoHFVLG4vA/R8LBycrXt2c3z7bWPonwZ08HhXUxmJnGN9ld9nZ637jk382NE+8q3/03UP6iOL/AIN55+4fu+Z9Hf4zlP7+PtRX82NEG4RVgen/AKt1D+oh+DeefuH7vmT/AI1lP7+PtR3f8m/jB4VbOrLnsZ1qhtVhrEVBVNU+Yl0lM0nRNNpDrabaXUIVb/vCfOO98PLFU8thSxUXGcVaz9G3PfmfKHhGoYWWZQxeGkpKV07P1r4s9TY2w4sEAebfyjeEGmso8tM5WWgJjBuJUylScCDc06oAMO3I6JdDKt9tzGqcRYL6dldSmudtu9br3o6/4OszeCzvxUvNmvev7N+w4QIsoi97G1xHy1e+59qlIAIAknhp+3A5K/vDXv6MmOw8CfnK3/H4M4f4T/8AJF6v+0T3Ljt58dhAEaZz/wDVAzU/gfU/6G7Fmr+bfcz0cB+nUfrR+KPAXLv/AABYJ/eOW/mxHyXmv+aV/rP4n6LYL9CpfVQ8Y8kzQgAgDE/+oJj/ACK/9UxXDz13r4lMvNZ7HcIv2sTIX+A1O/mEx9j0vzUe4/O3Pf8AOMR9d/E6Li8a+EAeO/HV9s9y7/zZTP8AtAxyjjr9Ah9ZfafTvgp8yt3v4ROc44MfS4QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBcj9NT7REMM9a+CX7VRkf8AwaR/OOR9i4X9Gh3I/PbiX/PsT9dnU8ZhqgQB4n8f1ApWJvlS8I0utMOTcgjK1D6WkTTjQCxUnkhV0KB5EiOccXY7F5fhYVcNLTJyS6Paz7b9h9OeC/D0MRgq0asbpSfwic20jB0theYTMYKxFifAs6h0OomaDiebl1BwCwWRrKVEC43HIkRyilxTnVKep1NXoaX2WO44rh7J8ZHTVop9Pve519k1xpZkZZYpp9Bz7qSMfZbPOJZ/Nu1KBmpUW50pXOtNjS+zcpBdQAtIuo6uUdTyXizD4+ao11on8e75c+84HxR4Oo0KMsVlvTnHp/Z+7psevMhPSVUospUqdNsz9PmmUvS0zLOhxp5tQ1JWhSdlJIIII2IMdKTurnzhKMoScZKzRtxJSEAeRvHplg1gXiGwdn5RZVuWo+JXW8NY1S2AkekG5kZxXidlNKV4BHjHPeLcsWNy91Iryobr1c16177H0N4NM9dHEPL6r2fLu6+x7+tnLvI2Oxj5xPq4LXNuhgD0H+ThaYd4WM0qt6O23PzeadURMOoFi4GmpdCL+xP1x9UcOwjTyeil+yvgj4k8Is5T4jlf9lfFnobG0HJggDgj5RyceZ+T3kZBIQqUqeOqLKTiFoCtbXpPaaR4d5tO46XHWPCzicoZbVcXZ6X8GdI4FhGfEVPV0+aXwZ5yL/Tl/uj9cfJa5H3a+ZbEkBADHzFM03la7NSS1szcrUpCZaebXpWyUTjStaTzBHMEbxtPDklDOqLb53XuZ4GdwVTKq0Wr7H0ljlH1OfnSVgSEAeHPE2T/AOl+zdHT8zVC/mVxxDjvz6Pr+CPsLwYf5NLvf/ZkYxx47kJdbqzNBwdVa3MC7EhKOTKx46Ekge8gD3xk4ag8ViIUFzk0vaWa1RUaUqj6K57A8F+XjmXHycWXFOn2Fs1+ryRr9a7QALM3PK9IWFAdUpWhHsQI+u8JSjQw8YR5JH598SY55hnNaq3dJ2Xq+buzqeMw1UIAt0C/X3KMAGgeKv8ASMAGgeKv9IwABIBvv71EwBdABAEYZ0ZeyWa/ClmBl1PpBZr9DmJNtR/xbxQSy57UuBCh7ItVIqcHF9T0cBipYLG08RH9Vp+rr7jwNwLVZisZU0eZnmyzVGWjKVFpQspuYYJacSR0OpF7ecfJ2b4R4LMqtLpe67nv/b1H6I4DERxWDhVTvdIdseKekEASTw0/bgclf3hr39GTHYeBPzlb/j8GcP8ACf8A5IvV/wBonuXHbz47CAI0zn/6oGan8D6n/Q3Ys1fzb7mejgP06j9aPxR4C5d/4AsE/vHLfzYj5LzX/NK/1n8T9FsF+hUvqoeMeSZoQAQBif8A1BMf5Ff+qYrh56718SmXms9juEX7WJkL/AanfzCY+x6X5qPcfnbnv+cYj67+J0XF418IA8d+Or7Z7l3/AJspn/aBjlHHX6BD6y+0+nfBT5lbvfwic5xwY+lwgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgC5H6an2iIYZ618Ev2qjI/+DSP5xyPsXC/o0O5H57cS/59ifrs6njMNUCAPGjjg+21YV/zTJ/2m7HKOOv0Cn9ZfCR9S+Cn9ErfWfwiQFHBj6PMT7DM1JPS0yyiYl3UFDrTiQpK0kWKSOoIiuE505qcHZrdPsKZRUk090ztb5PvNObpVSxJw14hm3ZpFDlTWsETT6ypblLW5pdlST1l3VAJ/aucgEiPpnhvNf8AEsCpS85bPvXP1Pmu+3Q+O/CLw+suxyxlFeRPn39Pk+6/U9Q43Q4iEAQtxEZZtZwcFmYuXikJVOVajOimrIuWpxsdrLLHgQ6hG484tVYeMpuPaezlONeX5jSxF7KL37uT9x4U4Irb2IcqqLU5oFFQUx2M8hQspEw2S26COh1JPxj5LzTCfQcwqULWSe3c918j9C8DiFisJCr2rfvHXe2/hvHkHoHoF8nFOSyOHHNygN9qqYp+aNQcdcWgBKg/Ly7qdO+9hcHl0j6l4cqqrk9F/wC1fC32HxR4R6Tp8Ryd9mvtfzPRKNrORBAHC3yilMM38mrU6wGn3zh/E9HqpQyNilE4htZWbHSgJdUSelhfa8eRmlJ1sBUguqfwOhcE1lR4io363X2/Yeay7dqsg3BUbEdd4+RVyPvMtiSAgBmY6kl1fCtJoLSw1M1fElKkGFqBKUrcnWgCoDewsSbbxtvDMHPOqduib91vtNZ4hrRoZNWm+iPpFT6njvH1GfniXQAHYXgDwu4i5xmpfK354zDAWlMhT6JTXQ4mxU4mU7UlPimy0jxvfaOGcdzXjqMe9/A+yPBlSlDItbfnN/8AZkeRyI7YJycKv5kZ15X5TyyO2/NbimWYqDdif+T5c+kzaiBvp7Nux9sb9wjg/pOa+Ma2gve9vhc0PjDMVluR1al7Nrb7PfY+iBhptmUbaabS00hIShCBYJSNgAOgAj6RPghtt3ZliSAgAgAgAgAgAgAgChFxAHgxnRhNvLb5SnOPBjLJlqTWplrF1GSUhKVInBaaCR4JmEr8OfLqeC8b4LxeJp4mPJ+S/ivtPtTwdZk8dkcaUneUNvZt8LMaccpOwBAEk8NP24HJX94a9/Rkx2HgT85W/wCPwZw/wn/5IvV/2ie5cdvPjsIAjTOf/qgZqfwPqf8AQ3Ys1fzb7mejgP06j9aPxR4C5d/4AsE/vHLfzYj5LzX/ADSv9Z/E/RbBfoVL6qHjHkmaEAEAYn/1BMf5Ff8AqmK4eeu9fEpl5rPY7hF+1iZC/wABqd/MJj7Hpfmo9x+due/5xiPrv4nRcXjXwgDx346vtnuXf+bKZ/2gY5Rx1+gQ+svtPp3wU+ZW738InOccGPpcIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAuR+mp9oiGGetfBL9qoyP/g0j+ccj7Fwv6NDuR+e3Ev8An2J+uzqeMw1QIA8aOOD7bVhX/NMn/absco46/QKf1l8JH1L4Kf0St9Z/CJAUcGPo8IAwUvFpyu4kMq84G1KaawxiJpusLQSCqmTZ9GmknxAS4F2PUXjoPCGOeFzLxLfkzXvX9rnPeM8rWaZHVgleSV18V77H0LtLS5LIWhYcQoXSsG4UOhBj6PPg2zXMyQBQi4+qAPAvNvB39635R7OPAjbXo9Hq04jFtAQAQnsJ2/bpSPBD6VjaODcb4LxeIhioraXkv4r7T7W8HmZ/T8ljTk/Kht7NvhZ+sQI5QdeOpeAfEyaHxu5wYEmHAlvE9AkMQyAWebkqpUq+lPjs40bR9B8FYlVcs8V1g2vt+DPlvwq4FqvRxa5cn6//AA9b46afN4QBGOdGXknmxwqY+y4nbBrEFEfkm1q/xbykEsufxXAhXui3UipwcX1PRwGKlgcbTxC/Vafq6+1Hgfg6oT87gluUrcu5JYmpLy6VXZR4Wcl5yXPZupUPMp1e+PlHOcDLL8xqUmtm7rufye3qP0MyvGU8dgadaDvdL4fdjqjwT1wgB85AYOfzP+UyyyoTDZco+CnDi6vO9mShtTYLck0TcWUp1WoDwTexEdd4IwEpVZ4uS25L1c/fZepnFPCRm0MHk7wqflVNrd/9r+492kiyADuY7mfGxWAMEw+zLSTsxMOJZYbQVuuLVZKEgXJJ6AAGHIlJt2R87UniVzH2ZWZOZriEobxhjCeqcmElRHooX2MvbVv+ltA9L35CPmjizErEZvKK/USXre/yPv3hPAf4dkVKi+dvv9osRoxux0RwOYPbxh8opjTHc02XJDL/AA41S5EqQdIn58lbq0m1rpYRpO9+/HfOCcGqeAdd85u/qWy+D9p8z+FPMrRp4KL58/Vv8WvYexkdUPmMIA5+4n85ZvIjg3xJmBSZOTqmJWnpaSoVPnyvsZucmHktNoVoIUQAVLIBGyDuOcYmJrxw1CVWXQ2HI8s/xfM6eE3Slztzt99jgA8bfE4FEGiZWAg//YKqf/8Aojlf4e4f9xL2o+ivxTYD/US93yD8+5xOf+5crP5Pqv8AvEPw9w/7iXtRP4psv/1E/d8g/PucTn/uXKz+T6r/ALxD8PcP+4l7UPxTZf8A6ifu+Rif43+J9uRfdaw/lbMOobUpDSZGqguEAkJBMxzPKKo8eYaUknRav1utvSUy8E+ASbWIm/Z8j0lyBzRRnTwdZf5miWZkZmu0pD07KsL1Ny8yklt9tNyTZLiFgAm9rX3jrFOfjKal2nzXmeCeXY+phn+q9u7mvcTBF08kIA8vflEsJCmYjyWzflZdX6FqzuF62+i1vRZ1Otgr8kPt7Hxc840bivBfS8pm0t47r1b/AAuvWdz8GWZPDZrLCyfkzX9n9nsOLbEGx2PWPmg+wQgCSeGn7cDkr+8Ne/oyY7DwJ+crf8fgzh/hP/yRer/tE9y47efHYQBGmc//AFQM1P4H1P8AobsWav5t9zPRwH6dR+tH4o8Bcu/8AWCf3jlv5sR8l5r/AJpX+s/ifotgv0Kl9VDxjyTNCACAMT/6gmP8iv8A1TFcPPXeviUy81nsdwi/axMhf4DU7+YTH2PS/NR7j87c9/zjEfXfxOi4vGvhAHjvx1fbPcu/82Uz/tAxyjjr9Ah9ZfafTvgp8yt3v4ROc44MfS4QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBcj9NT7REMM9a+CX7VRkf/AAaR/OOR9i4X9Gh3I/PbiX/PsT9dnU8ZhqgQB40ccH22rCv+aZP+03Y5Rx1+gU/rL4SPqXwU/olb6z+ESAo4MfR4QAl1uks17BlWoj+zNQk3JZR8NaSkH3Eg+6MnDV3hsRCsv1Wn7Hv7izVpqtSlTf6ysewvBnmK5mX8nJlrV56ZMzXqbT/mStFRutM3JK9HXq81BCF36hYPWPrrCVY1sPGad7o/PniLBPAZzWotWV213Pf47HUcZpq4QB5dfKM4MNMnsns7ZVpQRSKqvDlfcTy9Cnt2lq8kPJ+LkaZxPgnjcqmkvKSuu9b/ANvWdv8ABrmawuaSw0ntPf7H8U/UcYEEKIPMGxj5iPsUTm8XVPKvOfAedNFZXNTeC6kX6jKN85ymPJ7KcaHn2aioX2BTfpG+cKZj9CzHxcvNqbetcvarr2Gi8W5RHOMnnR6pXX39DsfQdh+uUrEuB6PiGhzrdRo1Tk2pyQmmjdLzLiAtCx5FJBj6STTV0fBVWnOjUlTmrOLs16UK8VFoOYgDy24tuFLF7Wb1Tz3yPpJxDUKmlJxtgtkpbcqXZpIE7KE2HpAGym+a+YuSQdLz/IaWb0braa5Ps+afVetHceCuM1lFsHi3+T6P7H2eh9OT25efq8w8KydWcplfnncIVtofoil4ik3afMsHqlaHUix9++9o4TieH83w0mnScvSt/wC/uPqjDZxluKpqdOqrP0/de8WMMT2I80MTJw7krhOoZl15aglb8pLrbpkhc27SZmlgIQkc7XueQ5iPWy7hTMcXUXj4+Lj7/V2d75dj5HiZvxTlOU0HOpUTfRffd9y9x7G8KfDlL8P2SU63V55mv5lYjmBPYurbIVofeAPZsNBW4ZZSooTsL7qsL2H0FgcHSwOHjRpqyX3+/a9z4w4iz2vn2PdefmrzU/j3v3cjqaPSNQCAOGOPLOSbwBwpJy/wrOBrMTMN5VFpYbcAclZUp/Rk3zuAholAV0U4PCPGzTG08Bg51pvZL7+3kvSzofBuTTzjN4bXhB3fZfovt7keYlLpspR8N0+kyCNElJS6JdhJ56EJCRfz2v74+T69aeIrSqz5ybb9Z9206caVNQjySsbL8wzKyT01MKCJdltTrqlGwCUgqJ+AMW4wlUkoR5vZesqlJRTk+SPTj5PzBL+HPk9qTiypyvo1fx3VJnE07qN1Ft5eiWB22AYbbIG/recfW+WYaODwUKMeSSXsPgzjPMHmOfVZX2jt9r97t6juGPWNACAPLL5Q/FJqeaeRuVDKiWBOzWLaogKNtMqjsJYEciC66s9bFHSNB4uxbw2Uziuc9vbt8LnevBhl6r5nPFS5QVvtf2HHG/XnHzafXQQAQAAkEEcwbiIaurA7f+TkxaiVoWcOTr7iyvD2Ik1ulBYNvQqijWUp8kvNuf6cfUHDOM+mZTTk+aVn3rb7D408JOW/RM4VeK2mvhv8Hb1HprG4nFggCAOKTLd3NngGzOwPJtpcq83RXJik3TciclyJhi3ge0bSL+cY9eCqUZR7T3slxjy/NaOIvZJ79z2fxPErClaGI8taFXNg5OSSHHkj7ly1nE+0LChHyPj8M8JjalD9ltLu6e6x+hmGrLEYeFXtSHBHnmUSTw0/bgclf3hr39GTHYeBPzlb/j8GcP8ACf8A5IvV/wBonuXHbz47CAI0zn/6oGan8D6n/Q3Ys1fzb7mejgP06j9aPxR4C5d/4AsE/vHLfzYj5LzX/NK/1n8T9FsF+hUvqoeMeSZoQAQBif8A1BMf5Ff+qYrh56718SmXms9juEX7WJkL/AanfzCY+x6X5qPcfnbnv+cYj67+J0XF418IA8d+Or7Z7l3/AJspn/aBjlHHX6BD6y+0+nfBT5lbvfwic5xwY+lwgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgC5H6an2iIYZ618Ev2qjI/+DSP5xyPsXC/o0O5H57cS/59ifrs6njMNUCAPGjjg+21YV/zTJ/2m7HKOOv0Cn9ZfCR9S+Cn9ErfWfwiQFHBj6PCAD2bGAOuvk+MXN0DiAzkyifUGmKoGMY0VGqwOu0tOpA8nEsq2++N4+jeEMb9JytQk94eT7OXusfJvhRy10cbTxsVtLZ/FfaerUdDPn0IAibPTLWXzg4R8wctZhSWzXqK9LSrqz3WZkDWw4dj6rqW1e6LdSCnBxfU9TLcZLL8fSxK/Vafq6+48G8GVOeqmXsmqrtLlq9JqXIVdh1GlbM2wotPJUOh1Jv74+Ts3wTwGY1KNrK913Pdezl6j9DMuxUcbgoVou919/mOZxCHWFtOoS60tJStCxdKkkWII6gjaPFTcWmnZo9NpNWZ0Xwd8QzGSmN5LIfMapplst6tNLOAa7NrOimzDi9S6Y+4e6htSlFTSjYAkgmxGn6M4Zz2GYYfxdV2nHn816H17Ht2Hyvx/wAIzpVXmGDjdPml6PtXvXcz2LBBHnHQz50KwAQBoTFLp0292s1JS806BYLeYStVvC5BiLJlcZzirJ2M0tJysnL9lKy7cu1q1aGmwhN/Gw2vBKxDlKTu3c2YkpCAI1zZzawRkrkhVsf4+q6aXQ5JOlKUjU/NvEHRLsI5uOrIsEjzJsASLVSpGnHVI9HA4HE5jiY4ehG8n7vS/QeGGIMXYszh4g63nNj5pcjVai16Lh6huG4oFMCiW2B/3i763FAC6ieV7D514ozz/Eq/iKL/ACcXu11fyXve/RH3Dwnw7RyHARjby3zfW/V+v3KyMsc+OhDTxdTZ7E1OomAKQ52daxnW5TD0kRbb0l1KXFexLesmNu4awjxeb09toeU/gve/cazxBjYZflNWtLon838D6JsN0KQwxgCiYapTZZpdJkGZGTbJ9VpltLaB/opEfUEUoxSXQ/ParUnWqyqT5ybb72LUVFotUSE3AuYA8Is9sVJzA+VAznxCy/6TTMPKlcJU1V7hJlkdpNAf/PcUDbwjhPHOK116eHT5Xb+C+0+zvBtgPouSKq1vPf27/Cwyo5KdmCACACAJB4dsXf3u/lScsau9MiVo2MZOZwlUz0U6sekSd9/11GkHe2rzuOwcDYy1SphW/SvXs/fb2nEfCXl30rJ/pEVvDf2c/c37D3SSboB5R3A+OSsAUPKAPn1xfg93LHjMzoyyWjspGn4jXV6InSADIVAekthNgBpQtS0bciCNo+d+M8H4jMI1oraat61/Z+4+5+BcyWY5DBt7x2fwfvV/Wa0c3Omkk8NP24HJX94a9/Rkx2HgT85W/wCPwZw/wn/5IvV/2ie5cdvPjsIAjTOf/qgZqfwPqf8AQ3Ys1fzb7mejgP06j9aPxR4C5d/4AsE/vHLfzYj5LzX/ADSv9Z/E/RbBfoVL6qHjHkmaEAEAYn/1BMf5Ff8AqmK4eeu9fEpl5rPY7hF+1iZC/wABqd/MJj7Hpfmo9x+due/5xiPrv4nRcXjXwgDx346vtnuXf+bKZ/2gY5Rx1+gQ+svtPp3wU+ZW738InOccGPpcIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAuR+nI9oiGQ+R618E23yVOR9/2NN9P+8XH2Lhf0aHcj89uJf8+xP12dT3jMNVC8AeNHHB9tpwr/mmT/tN2OUcdfoFP6y+Ej6l8FP6JW+s/hAgKODH0eEAEAY6Njt7J7iSy2zmaLhkcO1X0XEDbdru0qcszM7EblBKHB5p5jnHROD8f9FzB0Xyn8V81f2HOuNcoWbZJOC86O6+z3/E+hGWfZmaezMS7yJiXdbC23W1BSVpIuFAjYgggx9Fo+EWnF2ZnvEkFD6pgDw+4o8AjKf5SitvSzCZXCeZ0qa7TglopQ3VGQG51kG1ipY0v/xzHGuN8u1QhjILzdn3P5P4n1x4M85+lZe8HUflQ2X2e7b1EWxxQ74JtXo9Mr2HZmk1iTbn6dMJs6w6NjbcEEbgjoRuIycPiK2FrKtRlpkupaq04VqbhNXTJsyT4rsz+HyVlcL41k6hm/k/L2RJzjK+0r9DbKidB1H9FMpB2BIUBYAgAJjuWS8W4fERVHFeTP3Pub+D9Vz524o8HccRKWJy/aT3a6P1Ll3r1rqerWVufeUOc9EE7lvj2lYmWEBT0ky/2c7L7Xs7LLs6gjzT0O8dQhUhNXi7nzfjcsx+XT04mm4+np7eRL2tJVbUL+EXTyS6AKEgczaAMT0zLy8m7MPvIZYbSVOOrUEpQALkknYD2wJScnZHD2cPHllVgSqT2FsvG3s58wGgUfNuHHEqkZRfT0qd/SmwDzCCtQtYgR4uOzXBYCnrrTS+/v8AUdDyXgzOM3mno0Q7Wt/UvnZHmVi2tY8zfzaYzCzlrLdarkuf+RqFJFSaTQk3JCWGiTrc37zq7qNhubC3Cc74nxGZN0qHk03s+1/Je99ew+sOHeFMBkNFKMbz6t9vpfW3sXRGxHPzoAQBL/CbhP8AN58qbRJmYllP0XLzDr1adVbU2J+bPo8sFb7KDfbLT5i/nHauBsGvFzxTW7dl3L+79xwDwoZk6OXxwkXvN+7m/gl6z20FgLR2Y+Sit4AauOMUSWCcm8V4xqBSmRodImak/qJAKWGlOEe/Tb3xRJ6Yt9hk4ejLEV4Uo85NL2ux88eAjPzOWstXKuddZr0w/Wqgr756bdU8fgFJHuj5Vz7EvFZtVn0T0+z+9z9D8nwscHltKjFWsh5Rrh7gQAQAQAzsdCoS+XrlcooAr+H5tit0pdrlMxKOpeTb3JUPfGyZDi3g81pzvZN6X6+XvseHnGEjjctq0ZK6a/8Afdc+hbAGLqfj3JDCONqWtDlPr1Hl6iwW1akhLzSXLX8tRHuj6qi9UUz88sVQnhcTOjLnFtexjvvFRiFL/laAPJnj/wAHLoHFPk/mzLp0U+uSb+EKwvTZIdGqakifMntk3PgI5zxlg/pGVuoucN/Zz9zZ9D+C3MvF4qpgpPzt169vil7TlKPnU+rSSeGn7cDkt+8Ne/owjsPAn5yt/wAfgzh/hP8A8kXq/wC0T3Kv+Vo7efHZW8ARpnP/ANUHNT+B9T6f/g3YtVfzb7mehgP06j9aPxR4C5d/4AsE/vHLfzYj5KzX/M6/1n8T9FsF+hUvqoeMeSZwQAQBimP+b5j/ACK/9UxXDz13r4lMvNZ7G8Iv2sTIX+A1O/mEx9j0vzUe4/O3Pf8AOMR9d/E6MvF418LwB478dP2z3Lv/ADZTP+0DHKOOv0CH1l9p9O+CnzK3e/hE5zjgx9LhABABABABABABABABABABABABABABABABABAADY3EANuk0nFdAw3J0WgZy5m0KiybfZydPp2N5mXl5ZFydDbaLJQm5OwFt436PGOcRVko2Xof9RplXhXI61R1KlGMpPdtqLb9dhR1Zh/9vebP/iBOfjir8M85/wBvsf8AUWvwR4f/ANPH+GPyDVmH/wBvebP/AIgTn44fhnnP+32P+ofgjw//AKeP8MfkJ8vQJs5g/mprmMMUYzrop5kG5vEtccqC22NfaaEqcGpI1XNr2uTtvHi5ln2PzWiqWI02Tvsrdvpfae1l+T4DLG3hYKCfRJJd9klvsOONZPeCACANSfkZWp0Ocps60H5OaYUy+2rktChYj6Yu0qs6NWNSDtKLTXqKJwjOLjLdMTpKUxtTaNKU6nZ4ZpyFPlGEMSsrLY8mm2mG0JCUIQkEBKQAAANgBG9LjLOUrLT7H/UaZLhPIZScpUItvrpjv7jZ1Zh/9vebP/iBOfjifwzzn/b7H/UU/gjw/wD6eP8ADH5BqzD/AO3vNn/xAnPxw/DPOf8Ab7H/AFD8EeH/APTx/hj8hDrGF6viWco72Kcz8fYr+apwTlPbreKnZ1Eu8NtaEuhQSSBY2tcbRjYjivNMVRlSqxg4yVmrPr/yM3C8OZTgqnjMNTUJdsUl8EO/rGjrY2sIkB1vyPSAGrU8F4cqddZq6pA0+usudozVqY8qTnW1eIeaIVf2x7eDzfMcDZUKjsuj3XsfL1WPLxWXYLGxca0E7kmYfzX4kMGMJYwrxB4gmpJCSESmLJKXraeVhd11IdsBv63Pcxu+H44x1PatTUu529zv8TneM8HvD2KblGGl+jb4NfAkSX4ueLmQpkvKoxPl7XHEA9pN1HCkwy6s3J3DL4RsNtkjl15x7FPjyFvLotP0NP5GtVPBZlcpXhUaXf8A2bE6scTvFpXFG2aeHcKtuMBDiKDgttSm1cytC5lxw36b7W+5EY0+PKm+ih7X/ZmXQ8GGS02vGScu9v7LEJ4oYxZmILZqZm4uzJZ1axI1SrqZkEqvc2lmdDfM9RsLDkBGtYri7N8QrRagvRu/ft7jesv4SyPLnejSV+22/t5+82adTKdSKUiRpUhL0yST6rEqyltA87DmfMxpVatWxE9dWTk+1u5ukKcKUdMFZeg3osFwIAIAa8rh2qUrF9dreG8xMa4OnKw6hdQGHcSOSCHuzTpbCg0BcJFwNRNrnxjcMFxNmWX4aOHoKKjH0O/b2ms43IMszGr43FU1N+lJ27rrYVdWYf8A295s/wDiBOfjj0Pwzzn/AG+x/wBR5v4I8P8A+nj/AAx+Qasw/wDt7zZ/8QJz8cPwzzn/AG+x/wBQ/BHh/wD08f4Y/IT6tSsW1/DM/Ra9nPmdW6NPMlidkJ/HEy/LzLZ5ocbXdK0nqCCIh8ZZy1Z6PY/6iuHCmRU5KcKEU1yajFNe4X2mm2JRphpIQ00hKEJHRKRYD4ARoUm5Scnze/tN0SUVZGSKSQgAgAgC1aEuMrbWkLQtJSpJ6gixHwMSm07rmiGrqw3KRSMVYewxI0TD2cmZtBokk12UlTqdjeZl5aWRckIbbRZKEgk7AdY35cZZylZafY/6jTJ8KZFUm5zoRbfVqLftsKWrMP8A7e82f/ECc/HE/hnnP+32P+ot/gjw/wD6eP8ADH5BqzD/AO3vNn/xAnPxw/DPOf8Ab7H/AFD8EeH/APTx/hj8hGreHq/iemy8jijNjMTFFPYm25tuTrGMH5xhLzZuhzQ5dOpJvY2uLmLNXi7Nq1N06ig01bk/6jJw/DOTYWqqtCkoSXVJJ+1IdpN1E9Sbxoht43qlQXZzGFHxDTsS1/CddpjTzUpUMO1ZcjMIQ6AHB2iBqsQLEAi4uDeNhyzOcZlOr6PbyrXur8vWjx8fleDzOKjiY6kujs17GmburMP/ALe82f8AxAnPxxsH4Z5z/t9j/qNf/BHh/wD08f4Y/INWYf8A295s/wDiBOfjh+Gec/7fY/6h+CPD/wDp4/wx+RrzctjifpczIz2eOak7JTLKmZiXfx5NONvNrSUqQpJNlJIJBB2IJEPwyzl7eT7H/UVR4SyCMlKNCKa/2x+RtUimS1FwrTaPJlZlJGWRLsl1WpWlAsLmwubeUaPiK08TXnWnzk23blublThGlTjCPJKwoxjlwIAIAtWgOMrQq+lSSk28CLRKbTTRDV1Yb9KpmL6FhuQo1EzpzPo9HkWEsSUjI45mWWJZtIslDaE2SlI6AAARvy4yzlKy0+x/1GmT4UyKpNznQi2+bai2+92N/VmH/wBvebP/AIgTn44n8M85/wBvsf8AUW/wR4f/ANPH+GPyDVmH/wBvebP/AIgTn44fhnnP+32P+ofgjw//AKeP8MfkaDVCnnMfs4nr2NcV40rLMguRYmMTV5yoKZZUsLKEFzdI1C9gbXJNo8bMs/x+a0FRxGmyaeys9r+l9p7OX5Nl2VycsLBQvzskl7lzHFGsHvhABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABAFQCTYAn2CIukNwKVJ9ZJT7RaCafIFIkBABABABABABABABABABABABABABABABABABABABABABABABABABABAANztvAB18IAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAIAZ2J5PCc1jbLRzHswuWwOzi+W+fnEvPNBEqptwLUpbJC0AEA6kkW53HOPSoVczp4DGrK1fEujLxatF+WmrJKXktvfZmpcSLErLXPDX1xe1u46mkMoeDbGVXNMwDnE9SKw8lLLbNDzMcW644VHQUtzK19qq9xpAIt06xwOrxX4WMpp+OzPL9dNXbdTCpJLrd01HSvS9/ScNjnnEuF8ublb0p/YRPmZlpjHI/G9IlMQVdWMsB1qZEpSsTLlUS8zKzhBKZSbbQdJKwk6HUgBRBBAMdG4Z4nyvjDC1JYen4jE0lqnSu5RlDa86be+1/Ki725ptHTeG+Kf8Tn9HxO0+j7RCjZDqQQAQAQBS48RAFYAIAIApceMAVgClwOZtAFYAIAIAOkAUuL84ArABABABABABABABABcHkYAIAUcvMD48zrxTUJHL9yTomE6e8ZaqYyqLCphlL9u8xJsgj0lxO2olQQm+5O1/F4hz/JuEMPCeZKVSvNXjRi1F6f2qkt9EX0VnJ9F2c2z3iyhlknRoLXP3L79vb2kxVHIHh4ws3MM5p8RdTnZ5qXtPSk1jSSpKLFVlES0uAsA2KdJKuvWOZUeOuPczalkuTxjFvyWqFSq+W3lzbjdc7pL2HMqnE3EWL8xOz7E/jyOWsKP0aVqmKsJUCuS2JaJh6sOytIqsm+X2pyQUS5LqDhFlFKVFtVr2U2Y73ivpdbD4fG4qk6VWtBSnCS0uNRbTVul2tS9DO28P4uristh45NSjs7jyjyzaQgAgAgAgAgAgAgAgClxfnAFYApceMAVgAuDygAgAuIAIAIApcX5xNmCsQAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgDDTpDFmL80JLAeXtHarWKplgzMy5OOqakaXK30mYmnEgkJJ7qUAalnYRZxuMyzJ8ulmWaVHCjF2SjZzqS/Ygnte27b2iuZqmd57hsmopz3k+S+/wB/UTHXuCj54wsKLiXPSRVjKcSTJSi8MSLcrvyS00pfpPMeuhzVcXtcWjlmD8MM6GJeIwuVS+jx86Xjajl/yko+K5fquNvTuccq8YY/ENudJOHVW+232+scuPKTmAx8hzi+kZuds/jvDTK0CfcdK3JkyVRR6JNhZ3WFNhBCjupPPcmPDyXFZLLww4avkNlhsQ15KVlHxtJ+MhbkrSumuSfLZI17BVKKz6nUw20W1b0XW/36ENZb5c1XODiVr2F2MX1DCFCoeHGp6dmabJMvuPTMxMFDTZLzakpHZtuK2Nzt4GOpcTcRUeE8io4z6PGtVrVHFKUpRSjGCcn5LTb1NLs9qOx8VZ/iconTjh+b53JvRwqYecr5pTfEbWnKp2hb9CTL0cv6xzT2Yb1XFjta+0csfhRzONDx7yamoWvqvX027b3tb03OfvjTPFHVpVu239iA8/cvlZB4pwCW8xq9jBqqCemZ+RnaZKJJYl20JQlvsWgStb7zTY73MjY3jqnA3EU+NqGLc8HToeK8WoyjKb8qbbbeqTVowjKT25dTacg4lx+YV5yxLSp01d2XeSJReHTFwyzdxtnRmrT8mKQGg4abIy8s4qQCvVE1OTXcLm9ihCfW2BuLRqmM8IeXvMf8O4dwEsdO9tUnNa7c9FOn5Wn/AHSfLdq255OL42xtav4vBQuunVv4+3YcGD+HfJ7MjDk5MZbcR+L8TzNNcaRPTknU5OaZbWoFQC2TLJA1hKiBc2seceLmvhA4uyDERjm+TUaMal9MZQqRbS22kqjva6vtuePU4s4hw80q23fsc8imTlBzkzMwy5iObxRTKFiRdLkJ2elGmHl9k0jttQaSlJs4pQG3JNxe8dnw+KhmGT4LGujGlOtSVSUYuTS1N6bam35qT59bdDs3D2NxWYZesRiOcuVrGWpVKQpFCmqnU5puSkJZsuPvumyUJH5WAG5Owi/Ro1cRVjSpR1SlskjZ6lSFKDnN2SJMwBkLmXmNhSXxjiTELOTGBHWRMyrb8k3MViYY5h10PWZlEKTYgK1KsRcC8c6z3jzIsixTy/BUXjsSnpbUnGkpfsx03nUaeztZXWzOM5pxvKNZ0cDG9tr/AHv7Lesk7D/C1lni7DTk1gniHxXiWYlHkMzU9Ta5TajLodtcoU0hkpSSDcJKtrjnGj43wmcS5XiFDMcopUoyTajKnWpytyupOabt1dt/QarLi/P6El4zb0NNfH5HJDisQUrMzE2BaXMnMbEDeM3sN4W7OWblHKo60lIWpzSdCUoV2hW4DYBBvY7D6BpVcHiMqoZriIrDUnRjWq7uSgpXslfdtq2mPVtWudYwmeyhkf0/GK1+S9S9p0HOZBYUwLh2nVDiF4jxg6oVFavRafh5+WpkqlQAultx5tx59KeqilKdxy2vyKnx5m2dYidLhXJvHQp85VFOpK3+5QlGEL9Em3t1ObVeMM6xdR/RIWS9H3+LEXN3JKsZRZZS+ZWFMeTWY2XDSmlVWXqyGFzcrKvLSlucYmWUpD6ElaNQUm5SdQPQelwpxtQ4mzJ5Pj8KsNi3fQ4atMpxTbpzhJtwbs7NPns12+rknGGLrYuOHxi57es1snMmahnJK5jV+YzGq+GKZQ8RKpMjI0WnykyXOylWnHVKLrSiVKW5YJB5giMni/jCHCdXB4Sng4VZVqfjJSnKcbapyjFLTJKyS3bXpMviLifH5ZmTw9C1lYcOV3C7ijENCpf9+HNWcwvX5iVDzeFMOqk5apNt7lLky4tK1doUkFSG0BKbWJJBt4fEnhMweBrT/wAAwEatKLs61Txkqbe11BJxWlPZOUrvnbt1/GcaZlssPyW2q2zYl4j4a83KDna1hKg4wlJ7AM3JKnl46xHKNoXQWkLKFsPJQUtzDqroLZ7t+8VAAXj0cv8ACNw5jMneNxWHccVGSiqFJtqq2rqUW7yhFb615VtlG7ZnYbjjErBS8ZG9W9l6fv7vSPjEnCLUpLJx3EOXWb1bxPiyWlFTbLFaMo7Sqvp7xaSlpALIUElKVpWoAkX2vGr5f4VYVc2WFzbL6dKhJqLcNaq077XeqT12vdpxV1ex5OH40zSGKXjt433X3/scwUKr1fGa8H0nBFAdr2LsTSomKfTC7oblmwkF1+YdtZtlsmyl23Oybkx3bH08Jk8MRiMxqqnQoO0pWu5P9WMI/rTl0XTm9kdmzDO8Ll2Bjian6yul9/YdLJ4ZsO4eYpjmdPEW7h6r1LuytOos5JUSVLh0gtsqmQt1+x2ubXvyEcPl4SMzzCU/weydVKdPnKcalaVt95Km4xhfsV7drOO1uMs6xM28NCyXYm/h8xg5vZMYuyMwyxjBGKXcxctUPNM1WYnpRtmp0cOKCETClNWRMM6lJCjpSpNwdxcxtvCfGmW8YYl5fOgsNi2m4KMnKnUsm3FKXlQnZNpXadmtuRseRcY1MTiFh8YufJiJl5gCqZucSkxgySxXO4So9Jw6qqVWdp0qw+6px19LUs19mQpIBCXVdCQI9fiPP6PC2Qxx8qEa1SrU0RjJySsouU35LT2vFd573FWfYjKFTWHau+fcLudGS9QyWfy7qjGYldxXT6ziJVLnpepUuUbbb1SrrjXeZaCgorQALmx3jxuDeMocXzxdCpg6dGVKmqkXGU23acU9pSask7vY8Lh3ifHZpmUaFdq1vaamTuU9dzzxfjSoM4wqGDMEYfeRS5eapklLvuVGfA1zG7yFANtJKEbW7yvIxlcX8WYXg2hhqP0eNfE1k5tTlJKFPlDzWt5u7V77L0l/iTinEZdi1QwrTtz+/uEvN7L1WS2duE6OvMOq4lpU9h+oVSqLrUpJy7Uu2wtptCkllCVXClqKr7WAtvtGZwhxFPi/KsRiHhIUpQqU4RUHOTbkpN31Nrkklbe9zJ4Zz/H5rWqPEtKEFccuWeRmYmbGFZXGVVr6MpsuZqW9Jpy/RWpmr1BgpuJhXaHspVojvDUFLKdyBcGPH4j46yThvFSy/DUfpmLi9Mt3GlCV94rT5VSS5O1lfq+R5eb8bTpVnRwUeW139/d77j8VwvYfxNgibq2SPEJOYjqMm4WnPneekq3TXnki/Yuql0IWwT1KSSAQbG0anDwlZnl2MjR4jyiNKEldaI1KNRRf60VNyU0vSknyujXKXGWdYasvpMdn0tbb18zlr0TE2LsZU3KNco9hHMKqYmThqry5UFqphCO1mn0KHro9HCloWOYUPbHdJ4zLsty6efRkq2Fp0nWg+WvfTCLXR62lJPlZnTsZxBReQyxtLm9vWdwZv4OxrO4ew5kLlHPIyYyqpdHbexPjRf6Gal5VSlNNyMsq6A485ZbjpCk7lOpY12V8vcL5rlFGvW4mz2H0/G1JtUqHnNzVpSqTVpNQjtGGz66YvTt8/wCEq0YyeJrrxk29o+ntfoXT3Ig6Z4Kn8OZQMYnyfxrSMy5luUEy3T6nQpIN1gp3vLTrG6FnfSVlwE2BUOcdOoeF6OMzV4PPsLPCxctLlGpUvT+vTns4ra9lFpbpM3bAcX1sNWVOtRio92679r+sivL+Qezhzuy5wfQ69O4Vp9alJ+oVKZlpdhUzKtSzVi32bySkKD6ghW3RXhHQeIMZHhXJcXmFelGrOk6cIpuSjJzfO8WnbRut7bo6PxBns8Bl1PEYV7z5X7Bw5h4BmsseLKSwRL48qmL5H8ywqc+KnJyjJacdmS0yB2KEm2ltxRv5c77eTw3n34ScNzzGphYUZeN0R0ubuoxUpX1Nrm0l6yxwrnGPzhzniGtMez1DpysySmsweFWfzcxDmpXMLU1b9TmpeSp8jIOMtyUq66lCtbzV7lLSjcqIsQbxrvE3Gv8AgfEsciwmBp1pJUouUpVE3OcYt7Rl01LpfnsajmXFuZ4bMp4ejZpOy9fqIdywpGJMycSZM4NViSbo9QxOl+cq1Vl5WXcfalWpZcwSlK09mD3mU20ki/I2MdH4lx2D4eweY5gqKnGhpjCDclFylNQ3a8r9p81y5m751m2Ky3JqeIT/ACjtz9P/AKdbT3Cnh+mVFEpU+I2tU2bWkKSxNy9HZcUDsCErbBsbHePn+j4UczxEHOjk1OcV1Trte1No5jHjTPJK8Yp+r+xGeemQczlHkazienZvYkq9Wma9T6XJSc3Sqclt1cw+EKuUtg7Nhw7dQOl43PgvjuXFOdfQa2X0oQjTqTlKMqraUItq15Nbyst+l+p6+UcVZvmOYU8O7Wk97L+xr5YZJTeYHCdPZw17NKu4Wp7q6pPSshI0qTUy1IyzjqW1anGluHUloqvvztbbe9xHxt/gnE8cgwmBp1ZLxUHKU5pupNRuvJkoqzkl9ozLi7MsPmU8PRs4p2WxCWDpfE+MpDJvDCKy/T6/i+rSctOVNqUaU6wytC5h5YQsBGpLSbct7bDcCOn5xXwOTwzHHeLUqeFhOSi27OSahFNq7s5Pt27Toma5liMvyRYm/l2XT0XJQzoyyeyXzTy6kWsy6ziWSq8vUp2qN1amyjLTMtKtIsvW02kj7I6kHfkOUaPwbxM+L8DjKk8FCk6TpRi4Sm25VG9rSk+kXbY1bhriDMc2xco12lCCu+XvFHLDJvM3Oyiy+JKbU2cs8uphR9Bqs5TjNVWrIB2el5ddkNMq30rcJJtcJIjF4l4zyDhKtLB1KbxWLj50VLTTpv8AZnNXlKS6xirLk2mWs540jharo4NXa6/fl7O8Vs28l8C5acOGJcZUfPvEVbxTSpdRl5Byo0yaan5lxwNMs+jIbugdotAUUm4SFco8jhfjPPuIOIKGX18qp06NRq8tNaLhFJylLW5Wb0p2ut3bma5geKM/xGMhTttJ9j/8G3l1kRj/ADC+T8VmpKZgVpeOZ2Qn5ij0CQp9PMtMuNPONMNhSmypIWUC91beO0e1n3HWVZHxv/gk8JTWGhKmp1JSq6oqUYym7J2dr7bb9hl4zi7MMNmLw+paU0m7e0l3BnCS5WKA8xjzPCpPYxaYHpdMwW/JsMUxywBSvUhbjxCgQVLCATewEaDnHhUnhayllmWRWHb2lXVSUprtVnGMbrkk5NLm2eXiuNM2lPVRWmHS65/f1key/DtmynObEGF8SY4pmEcu6M+2WsfTUo0iZrCHUhbbDTLigyh5I1JcWbpuBYHcRt9TwhcOvKKOMweFlWxdVO+HTk403F2cpSinJwbs4RW9ubS3PYlxviXgoKnG9V3vbp9/f6Bezl4eJrKTIudzMwdj+v4vptFZbma7SMQrlnxNypWlLj0u82hstKQlWsJ7yVAW8L+Vwj4QfwlzqGUZjhKdGVZuNOdPXHTOzajOMnLUpNaW9mn6zGyjjHMJ46NLFWcZO3cRPQKNi/MLNw4Dy6kJWdrTMumarFUqK1JkKKwpVkLe095bi7HQymxVa9wLkdGzPMsqyDLP8SzWbUG3GEI211JJXajfZRW2qb2XpdkdLz3iDD5NTs1qm+SJ+a4YMCSeIZfCmLuJasf3wpxsGSp8hPUymLUTcgtySkrccT4XVcgc944/Lwk59WovG4DJYfRYPypSjWqLa3OqnGMX22WzZyGpxhn1S9WmrQXobS9eyIgzHyzxvkpjukSWJKsjGWCK3MmVpGJkyiZV+XmiFLTKTbSTp1LSk6HEWCikggHaOj8N8T5TxfhKksNT8RiaS1TpX1RcNk505Peyb8qL3V07tHQeHOKf8UqfR8QrT6ek08AYCx1nTmDVaHgeblsOYZo7wl69i2clfSUszBAV6LKM3AefAIKiohKLi+5AOTxBxDk/COChXzCLq1qqvTop6bx5a6kt3GDasrJuXTZO2RxDxRDKZeJpLVP4ff49OZLNJ4f8n8QY3qGB8PcUGIKrmVIha5uUlqnT3+yKDZYMoGdJCbgKSFkp623tzrE8ecW4HCQzLFZHThg52UW4VVe/L8prvvzTcbPpc5vLiviGEVVmrQfo+3+xC2IMPYiy7z6rmWWLanJVyqSMgxUqdVpJnsBUJJ5SkJccZueydSttSVJBKdwQbGOp5XmeB4gyWlm+ChKnGcpQlCTvonFJtKW2qLTTi7J9GrnXOHc8edYZzmrSjzLYzTcwgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgC5KdTqE8tSgIhuyuDrPhApdOofCLiTNGopQ5UsSVio1CoPoQS4iUkXHJdiXBAuUoQwtQA6uE8zHzf4VMViMbxVSyak7Qw8KcIrprqqM5S52u3JJvsij5Y4oxNbGZ1OEv1XZff2HnPiJ2axTl5Uc268FTmZVenZerSdTSnVNSrzky2ZNiXI3QEJLaEpRa/UR9eYGjRyytDJMP5OEoxlTlH9WUVB+MlO/Nyd227952anleBwXD7Uorzeb7en363PTrjKrKJDgVr9ACwmp4sqkjQJJCkaitb8wlbm1xuGmnVX6EDaPinwTYOWI40o4n9TDRqVZd0YtL2ylFek4Vw9h5YnNqUY9HcYfB21JSuCs580Kg4GKTN4h9EanHAAhUlTJYBxYN/U7Rb56C4JF77bX4WqlWtmGW5NRV5xp6nFc9deeyt26VHtfK/I2HjLEfS848XB30q3rOaOFSkS2MOP7B2MZ2my7ladptdxjPzfYoU6VTb/Yy2tayVkAPnT1BAO28di8JeInlPAtfL6U2qalh8NFXdrU46p2StHdw36P2HtcRQhgsgw9CKScub62/8HJxgzb1a42n3JR2T14EwhTpyVTUUfoX0pc6qeKXdR0lCkS7aSbWsqxO0eR4KcPDC8H2mnbGVqsXp87QqapXjZXTTm2t+a25kcK5esVlWJcna+1/Z7OR01XZKX4yuCehVKnsVbLB5FYlazJqxHQg8w460hf3KlJExLKDps6ki/d8xHGcDWqeCni+rSquGLWiVOXiqlnaTXVJuFRad4tPqaHhq88izFTWmbXr+725D5yHyleyVwZjecrmKafiupVmqiqTs/IU70NpppiWS2loBTiyQAhSrlVgVnluY1zjXihcX4zCww+HlRjSh4uMZS1tuU23LaMebaWyu0l6CjOc0qZzjFWlHS7JWPNTAsy9U8ADEU0kJnMQVCbrMxZKQSqamFui+nb1VJH0R9qZjSjhsSsJDzaMYU13Qio9fSmfT2TUFh8tpU/QSplbhCVzE428CYYqrCJrDlIlJjE9UlXfUmlSy0NSrZF+8kPupWU2sdAvtGg8WZtUyLhDFYug9NWrKNCDXOKmnKo/Q3CLin6djTeN8dUw2XRpQ21skPi0xRUsZ8RNPygM44jA9JpEvV8RybSygVSbfdV6Mw9t3mkIaLhTeyioX9UW03wWZVh8tyWefuN8RUnKnSk99EIxWuUeyUnLTfmktuZp/BWT0cXKWKrK6jsr/AH+6JN4NaZT8OcHmKMbmVZp1PruJ6lV2ltS4QgyctZhpQSm50aZdahYD1jYWtfRvC1ia2YcW0ctTcpUaVKm7u71z8qSu+t5pPuV+pqnE9aOKzuoqfJOysQRwKUNzFmdmNMy6wDMTdMpoEqpalKAm6u85PTLneudXZBhF73sdx3o6f4ZsYssybCZNQ2jUlvyXkYeMaUFt01ana1rr0Hr8TVXQwuGwMeSjd+sf2amWGUeZfGVXKxjvicpFJnHWWqJLYTptRp8tOSbCbXle2dcWtC3FqdK9CEk6wPubHVOGuJOKOHeFaWHyvI5zim6rrSjVlGUn+vpjGKailFRvJpWb6nkYDMcwy/BOOFotX5ys3fu226dRI4q5zMCjYdwblc/haRwtw9LnpKmqrMtUfTH5z0cJVKykxqCTKtrU0kE98qKANe5Eel4M6ORYzF4jOFiJVs1tOehx0RjrbVScLX8ZJKT/AGdN76drnqcLUMBiMyjOvPy73tay+/p6dhJ3DxWmsufkm5vM6qS2tTsvWsWzDSlKIe1vOraSbJ21JbaTsLb3F73jSuO8LLP/AAmrJ6MuToYdPba0YqT572bk9+48TOZvMM+qJPzpW+/vOSsiqZUqr8oBkxiGrqNRx/WJ+fxBiaqzClF9aBT3NbOqxKWkl5ttDdwkaAI77xtVw2D4FzHCUFow1ONOlSgrWv42NpW6yajKUpbt3bOlcR4PC5bw5ChGKUnbv6fMnHi9rjmKuIPBuU0yVLwnSqSMR12TUi7M++46piUQv75KAh5zTyJtflHNPBPl8MvybE55H89Un4mnLrCMUpVGuxyvGN+duR4vA+W0sTXniKquo7ff79B/cOVR/MN8kFM4xfl0sU9mQr1ekpUNL0NSxefcZQE2B06UggJFrKFo0/j7DrOfCmsBB3k5YelJ3W8tMFJ33V7ve/Vbmm5v4uvnk401ZOSQyfk+MGiXycxXjSptIVXH59jDsssgFcrKyjDaltDbuhTzylkXN9KSeUbN4cs2c82w+XUn+TjGVZrpKdSUkm+20IpLsu7cz0uKsRVljIYeXKnFHMGLqvTczceZl5o4tl5Wqszs5PStOVNtFxqTpcopbTLbYWO4FBtTiiACVKJ5x3PJsFW4ey3BZPgm4OMYSlZ2cqtRKUnKz3tfSldpJHYOHMsw2FyZSqRTck27r7/ex3Iy47IfIUBeOnlzj396JQm/S2SlZK5QhhCkqNyoamU3O5IB62j5cmlX8MlssWlfTNrPbap5bTW1naT7EnY+f7as3tT/AG/t3Iy4SVN4Q4M8387KolZddbW20pw2JlqTJBoAEkes+Xuoube7dvCi5Ztxbl3D1DkrXt+1iKmrs6Q09DZuJ68sdnEaC6aY+vZGnj5GMcyfkccganSHxN47fq1CVI60lxMxNOKdlQpZUonYOdopRJ3SSesXsjnlnD3hWzelWVsNGGI1dLQio1NrK29tKW3OyMHL8QsszqdWP6up+5fexI8rN0zAHEnw68LGCJ1QlqLKuYhxXMMv9m7MIYYdU32lvWL8wpT608ykI6Rp9SliM7yDOeNcyjvWao0U1dJzlFSt2KnTWiL6O/U82WvEUK2OrbuTsu9tX9i2Icz2pcpmX8szgLLqZZbmaaaXS5OsNIUFFyVS5M1J9pdyNIUlppJTuVJVfwB6DwXianD3gmxmbQbjPXVlB8rTap0YtbO9nJtPkmrek2LLa08Fw9iKsXZzdl9/USrxoViZnaZlnlgha5eh4hnZqo1ttpQSmalpBDZRKn9op11tRHKzdvKNO8EODpRxGNziSvUoRjCF+cZVXK8+9Ri0n2v1k8G5fSxuZuVTdQVyPuEaRTJ8cWPkUOVRTqM1geVFXZlUhphcyqb/AEMS2kAaw0h0A89Jja/CxVVXhLBvEPVUdeehvd6VDy930cnHbtRsPHqw8KlKMVaX3+/sFelS9Oq/90ZYiWlaXvmjA4mLNgWRNiVZZVqNvWDb/Q33T7I8fEVMRhfAPRTVvG4i2/WGuUtvRqj3czSJSnHh1R6OfzNLi2q8xi3ifoWW1Q1O4PoFAark3TlquzUJ2ZecbZLqOS0tIZWQlQtqXfePU8FWCp5dw/Wzin+frVHSjLrCEIxctL5pzcldrorG58D5Zh8RKpiaqvp2RJPBAwZXJ/MuRkEqZw/L5gPNUllP6Qx+hmC+hpP3KQ8VXA2vyjSfDJJTznBVJ71Xh4ub6vy56XJ9XotZ87GtcYQoQzmUaVrWIl4QGJTEPyg3EPiylMdnhylTk7JUgB8rCRO1Nx5eki4IV6Pq9Y2CgRsrbd/ClUq4LgbJsBXd6tSMJT2t+boxir9VbXbkr2d+RTnNWpHKsJh580r/AH9pF2eGKmF8WPELjETKVsUZxijSp7RNkqk5JN0ApHV94gXJN9jyjoXBGWzp8LZTgtNnV1VHs/8A7Kjs9/8AZFei265nT+EILCZFLES2bu/l8TqnHMrM5RfIcqw6omXrSMCylECVKOozc9oaWBqB31PubW6EC20cEyadPijwwrFrem8ROr/wpXkns10hHf1s4zhk8dnaS/WmRTwq4cRUuOGsVNloLkME4LRT2lFGoImp11ICQojmGGPEGy+oJjofhQzB4fhKlQb8rF13N/UpJ72vyc59ltu1I6Rx5iYpUsLHp9/kRHj6Wks2PlP568uzPen5r03D1PmXG0F1iUpjaVzXZK0qUkFTToJHlfrG65JOrwz4NY7uOjCVa0ld2c67ahdXSe0o293Qx8JThguEJ1pRWqb2e339B0Fx64rbp9By0owKFqamapiR5tWgkCTklttEgm9i7MgbWvYi9wI5V4EsslWxGOxPbGlRT3/+yonL0ebD1bdp4HB9O2OnXlyhFv3DuzGkXcs/kNxhiUQZWfOCKdQ0pCAT6RPFlly5QQLlT7neva+5vvfXshqx4h8MP0ye8fpFSr/xpapLnd2tFbc+isa/g4PG55Fds/gQfw90EVX5Q3B0vKtXp2DcLz1QeKUp0NLeSiSl0m4JBI7QgCx7t+hjqnhCxv0bgbEa35eKq04Ltai3Un7Hpv39x1njvERp4Onhk+fT79xt8QcjK5sfK8YAyunVk0BqTp9MqgCram3VP1OZZuCSC43KtN8hsog32MebwLWq8MeC3GZ1T/OuVScPQ4qFCEuS82U5Pm90mrbmjZXOpguH8RiYc5NJff1EzcXuM6tTqHgPKnDtRdoMvir0x2uOU8Ft0UyVbQFS7awPsaXVuIbJSQdIKeRjQvBVk+FxWJxWdYuCqPDaFTUt142bbUmv1nFRckmmtTvzRZ4SyulmeYt1t4w3739+pwXiLCmCMPZb1WsS2EqTLvUmRcmpVxuSbS4hxtBKDrtcnVbmTfrePq7B4/M8ZjKdCVebVSSi05O1m7Pbly7FsfQ9fDYShh5TVNeQrrbk1yPQjFVYqmQ/yP8Ah2TokwJPFsvhel0OlPbXbn5wNt9onSBcoLjjgIH3F9zz+PsswuH418KdaeJV6Eq1WrNdtOm27b9JKMY+u3I+XcNh/wDEs5VN8pSfsuQHwfYbkaJxzYiZpUugt0/L3TVZ5SgX5uYmJ9Ckuuq9Za1dk4olR6i20dZ8LOOq4nhCh457zxHkR/VjGFKSaiuSS1JJI6DxtSw2Fo0cPSVrf3GnxV4sbxtxF5jM1xsT+DcuaeqRptOdJMs7UFyvbTMytChpU4ntG2UEghIFxzvHu+DHKv8ACOH8JVw/k4jHS1SkvOVNT0wgmndRdnOXK99+Rm8I5bh4ZbUx1aN207X7jpLNf0zCvyHEvQqnperL+B6NQihalkrmJgS7NhcaioalGxAvpttHF+GVSzPwwvE0dqccRXq9Now1y7kna1/Sc1wFNYjPoqPJzfxFPhWpjGCvk75jMd+UTNV3Ebc/iqpHV3n0p7Qy7RVvZKWWkJA6albc4w/CTip5xx4spjK1Og6dCPob065W7XOTb7bIrz3ETxubz1Prb5/fuPNutyz1cyDqWNKylFXzExQpmqLqnZj0lyoTLqFS4bVYqSEFbaUoTyCSBzj7LwrpYHMoZfQ8jC4dOGj9VU4RandcnqSbbfV3Z3v6Dg8BkLg4rzU/X03PSDjdqSaF8mvVZyrLZmK1L1ejqYUUXDk23MtuL0m3duEO72GxI62j418EGHeL8IFONBNU3Ctf0QcGlffe147b7nAchlpzaE4LZXfy+wdWBcIS+WHyYMlh+exbIZeVWaw2t+q4nqi0ttSdQqCdbsw4VKQCpK3glI1DdKQOUePnOa1OIvCJPF08PLFQjVShShduVOk7RirKWzUbvZ7NmHisRPGZpKq4ud5cl1Sf3ZFmQOSmVeBm5rE2V+ZFOz7x7hymPMUqWRXZOVkpH0i4VdMuHS2pwAhTzmsmxta+268bcX8SZzpwWdYKWXYWvKLk/F1JTlo3/XcNSi91COlLbsPVzPNMwxdOFDExdOmuW3/lzmes1jGuKOJzH1ezSpiMP5jypl6XNUNlILFKk0JLsu205qV2yXNane1v3iTsLWjuOV4TJ8u4dwuHyWp43CS1TVR+dUm3abkrLS42UdNtkub5nauEMPgaWXOeGlqu939/v0NqMo6EEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAVSdLiVDmCDENXVgT/wALWaeD6TgCo8P+PZ+UodUZnp04fM+92DNekJx1bxQ26bJL6FPOIU3cKtpKQbG3EvCVwzmtfMY8UZbCVSEow8ZpWp0qlNKN3FXehqKkpWavdO2x80cVZTisLmc8TFNxk737Pv17DXovDlltk3iqjYwzMzsp9Ry8wpOmaw7R6o3Ly6ULb1ejekuhxSppbNxoShAuUpJHQ3MZx/xFxZhKmXZRlko4rEx01Jw1SbTtr0R0pU1P9Zyk7JtX6lnE8Q5nmWCjgYQdkrO19/d8XsiIcaYzmeKnjjyzo8zVatl9lGtVSZw9OsJaaqM06JQuOTjgeulgOIQtDZsVpSL2BWbb5lOT/i04NxuKhThicf8AknUi7unGLnZQjps5uLalNXSk9uUd/WpYDG8O5W8el+Ult3L0fPYk7OjMnAVB4dmOGPIh6UnmH6YJCsVGlzaZmUoVOUq72t4Eh2afBWNIOr7IpaiNhGncH8O53mOfvjDiVSi4z1wjNOMqtRLybR2cadPZ3tbyVFX3ZgZDkuMzXMPpNdNJO7bVvv6DS4Tqtg2hZ+ZuVWs4houHBIU2lUCmNT9Wl5c6EJcmHQlK1BRAK2he/QjpGZ4U8PmuMynLqGHozq6pVqsnGEpbtxhHdJrdKTt3Pqevxw51cbTo0otqC6K9iJaKrCOdXyqGZjmLK7RZfLiRxWufrCqjU5ZqWqrck2iVkJQKKwHULW0p5VioFCRf1t9zxcs04R8GuChgKVR4udJQhpjNypuo3UqzaSbi4qSgr2ak9uRiTxNbAcOQwtBPVPd2u7L7v4D+4pM0qXmHma5l9RaqzUMrcIUsVHEq6bOD0aqTqmytiULjZ0raZaGspB061AH1Y1zwacNV8ly//FsVTccZiZ6KSnHyoQTtKdpK6lOWydr6U2uZn8IZNGbnjcTHaK6/f2+i3aPOj44wdlp8hg1SaXi+hTGKV4AWlmQlaxLuTPptQv3Q0LqKkqmd06NtNul41XE5RmvEHhjdethqio/SVeThNR8XRtvq5Wahz1db+g0qVCvi861Si7OXY7WX/hz/AEuRRS8MUymNAJbk5RqXSASQAhATzO/SO6V6rr151Xzk2/a7n1ZTjopqPYkh3ZV43oWVnGvQMZ4qdTTsL1egP4cnaq5q7KnvOTDb8u48eSGlKQpBWRZJIJ23GpcW5LjeJOEquBwS1VqVSNZQXOaUZRmo9sknqUebttucv42wFfF4SFWkr6Hv9/WdC8QmU+UVbxZMZvYvzgey/oExR2pDEDVMmZZw1llsKUyhhStS0ulK1IHZJUVJIsBzjjvA3FHFOBwqyHL8uWJqqblTc1NeLcrKTktk4ppN63FJ878jk+U5tmmBpTwuFjfX7vv27FktnhlrXPkm8VVOhVOj5fsowdV5Ch4e+eGkTsm0yh+WlUdmF6w4pKG1WAPeXsTzNurwhxBg/CZh6OJhPEvx9GdSpok4ScnCdR3tp0ptq7tst0uRgywWJpZkozTl5Sbdtu1kWcIGZWE8t8SYhwHiyfk8LNYibp1Xw7Pzz4YlJlbci1LvSnaKIQlxJaQoJJBUFG3KN/8ACvw9meeUaOaYGEq3iPGU6kYpylFOpKcZ2V24u7TaWzW/M3XjHLcR9IhiIRbi4pbdNkL+JeDykzmPMS1WpZy0Om4AqeIXqxUJZ2jSyZ9pp6Y9IcZE6p7SkFZICy3skx5GXeFbF0MBQw1HLKk8TTpRpxanNwbjDQpeLULvbdx1bs8qjxPi6eWLAwpLla9t/hcaHGfn7hnHuR1Wy4yyqbOJJWTfbqOJMQySguQlgwdbEqy9Yh15bxbuW7hISQTuQPc8E3A+Y5NnFPOM4puk5JwpU5bTlr2lOUdnGEY3tq3bd0tk3d4dyfFxqvGVY6YwTe+2/wB9kiQs7MSYMoPyUdEypw9i2jVuqzklQ8MpladVm5p6xcZ7dWlLhUAEtubq23secapwfl+bY7wmVM6xeHnThGVeveUHFcpaVdxtu2uXejy8pwtbF55CU4tJyb5W5v2dRi8OdVwtIcc+JqviDEFLoLNBwWiVkRUp9uWSp2dmda9BcWkEhqXSCADsocrb7h4RMPmNfhHD4bC0Z1HWruUtMXLanCyvZN+dN9nLqb7x5OpUlSw9OLaW+yIqzqxnLVviH4iMeUueZnqdIoapNKmmHErbcEpIgXStCjcF547ggcjsbxvHBmVTwXDuU5dWi4znepNO6a8ZUfNNLdQj1ue3wnSeDyKdWSs3d+729UdF5t4lwjhj5ICmZX4dxXRKlX5uh0fDIlabUpd13U8tlEwotodJG3a3NyLne4vHGeF8vzTMvClPOcVh6kKUalaveUZpWipOCu4pP9W3LbsOSZbhq2KzuEpRdnJvdfMQeGzOHDWVOO8WZd47qkrhigVysGs4VrM6Q1KKfdShEzJuunutqCm0LRqsCkkX2Aj2/CLwnmHEWGoZvllN1qlKHi6sI7y0xbcKkY82rNqVrtOztzNr4zybELG/SqcW4y52+/3Q86twk5YN43qlaquaTkllS9VHKtPYTdflGJSzi+1Wyqc1haZcuK1FG2x036xrWF8KHEbwMMJQwKljVBU41kqjnstKkqdnFzUVa/bvboa5T4jzRZf9AgvRfe/st92RLxR8QVFzFyzqODMvJgTeWdHT6ZiTEDaNErVVS2lcvT5NRP2RsuJT2jmnT3EpSTvfe/BvwJi8jzCGZ5tHTi6nk0qb3lT13U6tRdJaW9Mb33baXT3uG8hrRk8filaME2r/AH/87xy45q2FMF/JD4FydomLaNV8R100yjVGXp9UYeeCpl4TVQWUNruBYOpJsfWAPO8eJkmFzLOPClis+xOHnClR8bUi5Qkl5EfF0Um42v5rXLltyseNleGrZhxFGdWLScr7r+w/OG7NbLXA/wAnDIjFOIaRSncJzVXM3TJielxMpLE6+4kMtFeokhSUosLknaNX4/4bz/N+PprBUZzWJVG01GWnyqcE9UrWsmm5XdrczBzrB4mWdVYwi95W25EHcM1el535RfG2aWY9fptBxBVMJrnZtFTnWZdLC52aSGJRCnVJuGZeXSkBP7a9ri/S/CJgJ4fgTCZJlNGVSlTrKK0RlJtU4PVNqKfn1Jtu/osbFxDgHgMuw+EppuVrysn6fv3jbxpjeYT8odjTObCBTidOGccyqZdqnLGmpyMtT0Ss0y0u+la1JddANyFFCbc9/cybI4T4Aw3D+O/JPEUJtuX6lSdVzpykuaSai7c0m7nvZbk9TG8KSpJeW22r/f3HYWMaBljxW5f4MxfgnNNug1SjF1crOyno7z8u3MISHpWalHlDQoltBsqxCkbXBj59yjH8R+DPH4nA5hgHUhVsnGWtRbg3pnTqRTut3yumnvZnOsvx2YcP4uUow3ezutn7hqyuLcoOEfLGs4bpOIns1M165OKnZqnSrrTtRqc1o0o7YM3RKS6AABq9VOojUTHu1Ms4q8KOZUsXXorCYKklFSakqcIXu9OrepUk93bm7XskZEqWa8S4/wAZKL39HJej72OSsIYnxHlvxAUDO2vsuYkr66vOzeOkU4XW/LTyAh8MI21BjQyUI5ENn2x33N8owOe8P1eHcI1SpqEI0NXJSpNuOp728ZeSlLo5HWM14cf+ARw1FXlDf7/f0nYuYuVOFOIfEdAzayszmplAmZqkJpk5PNMNVBicl0rLjVmlOILMw0pxY73LVZSbjf534f4ozTgOhWyPOctlUUZ64xbcHGTVpbqMlKEkly7LpnKsqznH5A50lDzvd6eT9QysV5oYGyS4cmcgcgqujFmPDKuszVXZmUvt0lb+ov1CcmG7oMwSVFDKTq1abgBIvsWVcN51xlxA+J+J6ficNdNQaadRRtopU4PylTt503ta9rtu2Rl2U5hn2YeOrRtFu7b+/wD70EfgzrWGMBZr5h5bVCps0qdqcvTJ7D/p0wls1JtiXUw/oJsFOpWNak3uQu4BAJj0/C5gsxzfL8Hm1KDnGm6sKmlX0OU1KN7cotbJ8rq3YexxpgalHE05Qj5Cil8AzlwNkNlPnJU8ysa4/nMSCr4iTXKVlqiclexnKi46m7zqrKWZVK7OKC7ISR92bJNrhTO+NOJsohk2XYSNJUqTpTxWmd40lF+TFbR8a15K03k/9qvI8PCZjm+JwH+H0lamubs9l8xy8ZWY2E69lTljgaiY/pC14hzEprVSmqXVmJhcnLtrKlPlIJTpS4ptXfsLhJN948bwU5HmeBzPHZniMJP8hhqrgpwlFSk1ZRTaTu4prybuzZhZLSxGGxMsQoNOEW1dPn0Fmt41yv4WMkqzgDLKrqxxm1VZl59qUXPtzk+/POJ0Cdn1oAQw00EpOkhIskJSncmMHBZPxJ4Ss6p5pnFL6PgaaSctLhBU07+LpKW85Su97vd3b2SL1HC5pxHmCnUi3fm97W+/Xp7jmvh/k6Lh7jcy1l8S4okpRrDtCqtbnajVagmWE5PTBDHaFS1AFS1vPqAJOwPhHZ+PamLxfB+M+h0JN16lKlGMIuWmnDy7WSbSSjFXS52OjcX03hcpo4Kir9y95tcWlekcxuJbFDWFalKYlk8O4BlpVj0CdTMMOzL02qcdbSUXRqKGGknc80+YjG8F2Ar5Hw7SljIOlKviJN6ouMlGMFTi3ezteUmuXXvMDhLAVZZbipNWlJWV19+w7oxQcu+JTgocZpmN5ak4erLEtPM1OSm2FLpz8u4iYCXELIF21oCVoVp2BG0fMeXf47wDxcp1cK51aTlFwlGVpxmnC6au7STvGSv27nLcPPE5Xj41FHyoP07kLcOeK8gsFZj5gYTwnjyUxTU0My8ziXMGtVWXlkVWbK3EIlJcEpSWmkJUoFolA1Wuo7x0Pj3L+Nc4wWEx+YYWVGDco0sNCE5OnBKLdSbSbUptpeVaW3JLY9bNpZpmEo4nEp3leytey7WcxV7Gj7XHBi3PCgsnESKHmcuZalpLsnFVCnyssmnupaKSUlXZF1SDc6rA7Ex23A5NCpwTh+HMS/FOthUm5akoVJzdaLlfdLVpUlZW3XQ6Vg8nqYvhHxMfOd3b7DuDF9Cyk4rMpMN4iwvmKmm1KkPLeo9bpr7PpUgp1IS6xMSzxGygkBTawDdNwed/mjKsdxR4NM1r4bGYLVCqkpwmpaZqLvGUJx6q+0o3VnuuzleCxeYZFi9cE0+vpOCs+8sKPgLODKfBv9+tzGM5imsKp+IGZqbkpOVprHbyxS4tpm/ZXQpwa3CeQItYx9P8G8TY3PMqzHMHlqoRw9PXTajUnKctNS6UpW1bpbRS52dzoFHiHMcxo15VotRUdkk+f28jqbi4x7hbFDWUeDsN4kplfL+K3avOIpdTRM9m1JSqyjtA0ogAuPN21HmkEA2McX8FWR5jl9fMMfjKE6emiqcdcHG7qTV7akntGLvbo9+h5PBmDqvN1OpFpRXVCdwg4lwbSsS51V2v4todGmprEMnSWWahWWZd0sycsCohDik93tH12IvchQ6CMrwr4LNsVDLcNhcPUqRjTnUbjCUlqqT23Se+mC27LPqXONJVcTmemEW1FdFf78jj2t1FvHFArlUmp5qTbzDzCXeamHVNITLTVSDYUpRUSEiXa5k7JHkI+hMHQlksKVGEG3gsMtkrvVCleyVubm+zd950OjF5dwoklu4+2/x5HbHFvjrCeJMIZV4HwxiilV5M5jFE9OsUypomVCVkZdx1OstLIA7QtevzIBANjHzb4LMmzLBY7HZjjKE6eii4xc4OPl1Zxi7akt9OrlyXPmcy4OwVWecxnUi0opvdW+/qMPDDmthFOSTfDvmLVJeh4hpzUxTKOJx8y7ddpjpV2ZYdUAkuoQ6WlI1a+6FC+8T4RuF80jnT4qyqm6lKbjOelanSqxtfXFXeluOpStp3s7bGLxHlGLwGYyqxi3Fu97X+6/8ADNQuGzK3KPE9BxpmDnSKzg3Cj4mKJTK6ZGUlZd1tKhLqecSrVMLaTYoFgSpINj6sU47whcS8UYWrluWZbor4laZyp+MlKSlbWoxatBTfnO7sm1dcynFcQ5rmWFWD07Wttff3eruOe+I/MOY4lJtyVwxLTLGW1EpsyugKn2Syuu1N1tTYm+zUbpZbTdLZUASpalbA7da8H/DseA6fjca08XWlFVNLuqVKLT0XWzlJ7zs7JJLpvu/DXDdehh6mJrq0pJ6V9/vyOunq3gHiv4GlYRomM5TCdfLciuekJ4NOTlHnJN1tfZzEqtSSpGtvTcWCkkEHpHz/AAwed+DPjL6ficLKtSTqKMo6lCpCopK8JpNJ2d7buL2aOYxji8lzNVZ07uDfcxsYAwLl1wvYvxHmVmdnLh6Yq09SE01hmSp7VPaTLB4Ons5Ztx16YdUtIAKb2AsB4e3n2eZ/4R8NRyjJ8sqKEJubblKb1adO83GEIRSfXrvft9PNM0x3EM4RjRtbsXf6EuvU5nruKV5kcQ+Oc0E0qZodNripSVpElODTMehyjRbbedTeyFuFSlaeaU6R437nleVfg9kOFyd1FUnS1ynKPm66kruMX1UVZX6u523hXLK2WZbpredJ3+/3uWxnG8BABABABABABABABABABABABABABABABABABABAGhUqVTKxTTJ1anS1UlCb9jNMJcSD4gEbHzG8ZFGvXw1TxlGbjLtTa+BbnTp1Y6ZpNekRJTAuCpCotTclhKkS002btuokEakHxFxsfOM6pmmZVYOE682n01Mxo4PCwlqjTSfcKtXoVFr8o0xXKVK1dhpZW23NshxKVEWuAettoxMPisThJOWHm4N7bOxfqUaVZWqRUl6TZkKfIUumNyVMkZenSaPUYlWUtoH8VIAv5xaq1atebnVk5SfVtt+1lUIQpx0wVl6DQm8M4bn55yan8O0qemlm63pmnMuLUfEqUkkxkU8bjaUVCnVlFLopSS9zKXSpSd3FN9xgOEMJKCQrClFUE7JBpLBt7O5FxZjmCd1Xn/HL5keIo/sL2IUpak0qSpbsjJ0uTk5F2/aSzEqhtpdxY3QkAG42NxGLPEV6tRVJzcpLq22/a9ytQhGOlJJdxoN4TwqzNIfZwvR2n0K1JcRS2UqSedwQm4PnGS8wx8o6ZVptdmqXzKPE0V+ovYhf63jzi+Yn2GJmUdl5lluZl3ElLjTqAtC0nmCk7EeRiuMpQkpRdmuTWzIaUlZ8htyeB8GU6qNT0hhSkyk40rU281IoCkHxBtsY9OpmmZVoOFStJp805PcxI4TCwkpRppNeg2FYRwmp4uKwtRlOE3KzSmConxvpvFr/ABDHpWVadvrS+Zd8RRf6i9iFWbp8hP0lVPnpGXnJBSQlUs+wlbRA5DSRbbp4RiU6tWjU8ZTk4y7U2n7eZclCMo6ZK67Bspy6wClaVDBlGuDcXkEH649V5xmzVvpE/wCJmH9Cwf7uPsHN83080T5sMhLfNujR6J6OnsdPhotpt5WjyvHVfG+N1PV23d/bzMzRDTosrdnQTpfC2GJOeampTDVJlJltQU28xTGW1oI6hQSCD7IyZ47HVYuM602n0cpNe9lCo0U7qK9iMk7h3D1SnjNVGgUyozJABemqe06sgbDvKSTFNLGYuhDRSqyiuxSaXuZLpUpO7im+5Gw3R6QzQ10xmlSTNNXfVJtyiEsqubm6ANJ+EW3iMRKqqrm3Jdbu/tvclU6ajp0q3ZY05bC+GJOeampPDVJlJppWpt5imMoWg+IUE3B9kXp47HVIOE602n0cpNe9lKo0k7qK9iFaalZWekHZSdlmpyVcFnGX2g4hY80kEGMSnOdKanTbTXJp2ZclGMlaSuhqt5eYDaeQ4jBlGC0m6Saeg2PsItHrSzjNZKzxE/4mYawWDTuqcfYh0PScnM0xUlMSjD8kpOky7jKVNEA3tpIta+9rR5MalSFTxkW1Ltu7+3mZjjFx0tbCdJ4bw5T59E3T8PUuQmkeo/LU5ppxPTZSUgiMqpjcbWhoqVZST6OTa9jZbVKlF3UUmvQi1zDGGXaiqcdw5SnZxS+0MwumsqcKr31aim9773vExx2NjDRGtNR5W1StbuvYOjSbu4r2IzT9AoNVnBMVSh06pzATpDs5ItPLA8LqSTaLdHF4rDx00akorsUml7miZUqcneUU33G3JSEjTZEStOkpenywUVBmVYS0gE8zpSALxZq1ataeurJyfa22/ayuMYwVoqwiVDBeD6tU1ztTwtSp6cX6770kgrX7Tbf2mM+jmWY4eChSrSjFdFJ2MaeFw1SWqcE33G/SaBQ6Cw41RKPJUhDhu4JSWS3r9pAuffGNiMXisW069SU7drbLlOjRoq1OKXchXjEL405rAeCZ2oPTc3hGkTEy6rU66uRRqWfE2HOPXhmuZ0oKEK80l01MwpYPCSbcqau/QhwSFOp9KpqJOlyEvTZRPqsyrCWkD3JA+MefVrVsRPXVk5S7W237zJhThTVoKy9BgqtEo9ckUy1apUpVpdKtSG5uXS4EnxFxsfZFdDE4jCy1UJuD9DaIqUqVVWqRTXpQnSeDsI0+XmGpHC9KlW5gBL6USDdnACCAq43FwDbltGTUzHMKzTqVpNrl5T27ty1DC4aCajBK/oRVWDsIqlnmfzK0dDbqdDqUUxpGtPgSlINthtD/ABHMNSfjptrleTfxZMsPh5KzgvYjepVColClnGaJSJOkNOG7iZSWS3rPmQLn3xj4jFYnFyUq83Nrldt27iqnRpUVanFLuVis/Q6JVXm3KrRafVHEJ0oVOSTbxSOdgVJNhEUcVicOmqNSUU+xtfBlcqdObvKKb7jLIUql0phbVLpkpTGlqClok5VDKVEciQkAExTWr18RLVWm5P0tv4kxhCHmqwiTeBsFz9TdnZ3CdJmpt1Wpx5yRQVLPidt4zqeaZlSpqnCvNRXJamY0sJhZy1SppvuN5/C+GJpTZmcNUmZLbYbb7WmMr0JHJIunYDwEWIY7HU76K01fd2lJXfbz5+kuujRfOK9iFKTkZKnSKZWnybEhKpJKWZZlLSEk8yEpAAjFqVataeupJyb6ttv2suxjGKtFWQiVHBmEavU1ztUwxS6hOL9d9+SQpavabXPtMZ1HMsww8NFKtKMexSdjGnhcNVlqnBN+lFZfBuEJSRXKy2FaQ1LLVqW2Kc0UrI5E3Sb8z8TCeZZjUmpyrTbXXU/mTHDYeCtGCS7kbsjh+gUycMzTKFTabMFJSXZSQaZXY8xdKQbRYq4vF146atWUl2OTfxZdjSpwd4xSfcYZjC+GJydcmZvDVJm5lxRU46/TGVrWTzJUUkkxXDHY6nBQhWmkuilJL3Mh0aTd3FX7kbjtHpD9Ebpj9Kkn6a3bRKOSiFMpte1kEaRa56dYsxxGIhVdWM2pPrd39vMqdOm46WlbssYJLDuHqbPCZptAptOmQCA9K09ppdjzGpKQYuVcZjK8dNWrKS7HJte9kRpUou8YpPuRsVKk0qs030Or02Vqkpe/YzbCXUg+IBGx8xFqjiK+GnrozcZdqbXwFSlTqx01EmvSIkrgTBMlOomZTCNHYmEbocTT2yUnxFwd/OM+pmuZ1YuM682n/uZYjhMLB3jTSfcOvrHkGYN+qYTwtXJ4TVYw5TapNAW7aZk0LXbwKrXPvj0aGPx2FhooVZRXYm0vYYtTDYerLVUgm/Siym4PwnRqgJuk4ZpdOmwLB9iSQlY9irXHuia2Y4/Ew0Vq0pLscnYU8NhqUtUIJPuHHzNzuY80yggAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAsfCACALO0a/XUf6YirTLsKtMuwvsbDa1+UUFOxXSbX0m3jaF1cXAAk2G8G7ACCOYI9ohdMFupJUQFJuOY1DaKrPsJsy6xtcC4iCCkAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAEAHKAHfh/AGNcVS7b+H8MT9SlVq0pmUNaWbg2P2RRCdiN99usa5j8/yXK5OGLxEYSXS95fwq77jw8ZnOVZe3HE1oxa6Xu/Yrv3DcqEhN0qvTlMn2TLz0o+piYaJBKFpNlC42NiOm0e1h8RRxVCFek7wmk0+1PdM9WjWp4ijGtSd4ySafanyOlsA8PFPxZlvQsTT2LXmGKgyHjLSUmglsXIUgrUojUCCL6fdHEM+8IWIyrMq2BpYVN03a8pPd807JcmvT6zlGcca1sux1XCU6Cbg7XlJ79jsktren1kKTeC5yncQScCzaXC/89NyQULJU42twBKxfbvIUFDpvHUKOc0cRkH+K02reLc+2zSd0+u0lZm/Us0pV8m/xGHLQ5dzSd0+57HZuK8ksvpHKHFBoeGGWqs3SnlSky4+644laEFSVAqUbE6d7De9usfNGVcbcQV83w6xWIbpucdSSilZuzWyW2+13scIy7irOauZUFiKzcHNXVklZuzWyW2/bsciZPSUlVOJbB8nUJNmfkX5tQdl5hoONuDsVmyknY7gH3R9FcX162G4bxVWjJxlGKs07NeVHk0dt4mq1aGR4ipSk4ySVmnZrylyaOxsxsfYLy0qdJlKtgpM+ifl1uNPSsnKpQNCgkoOsDfcH2ER83cO5DnPElKpUw+L0um0mpSqX3V09r7c0cMyTJ80z2nUnQxOnQ0mm533V77HKGb2Y1BzHxBQZ6iUiYpSpGVcl3vSFNnWkrCkABBIAHe+Md/4R4dx/DuHrUsVVU9clJWvs7Wd9Svvt7DsvDeSYzJKNWniKinraatfbaz5rrsdJ4RQk/Jqu/YwpRw1P/c3PrPRxPN5NeEhb/wD3UvhA5VmLf4dL/wD0p/CJy1k005+ejwNqaWE/OO+pBt+lrjvPGM4/gxjLP9Tt/wByOwcTyX4P4mz/AFftRK3FQm2PMIBsBKjSX7WFt+2EaB4Ln/8AAxV/24/9TTvB8/8A4mIv+3H/AKj6wJj3KPEysH4HGEPSqn6M3LNKnqMwpoOIZuslZUVG+hW9iTtGrZ7kPFuW/Ss0+laad3J6ak07OW21kuq2NczfJ+JMAsRmLxFoXbemcr2cttrJdV1HPjKlZAYYrLcriyg0alzs8wp5sJp7t1JvpKgWhZO46WjwsnxXH2ZUXUy+tUnGDSflx2fOz1Pf3nk5XiOMcwpa8FVnKMHbzlz528rmcTYjk6VUc6KtIYIZ9IpEzU+xorTYWdaVEJQBr73M/dbx9PZdWxWHyanVzR2qRheo3bZq7b225dh37A1MRRyuFTMHacY3m3bZq7fLb2HUy+FejrosuGsVVBiqdknt7y7TjKnNPeCfVIBVyJJsPGODLwo4uNeWrDRdO7tvJStfa/NXtzslucej4QcUqrboRcLu27Ttfa/NXtz5HGDja2phxpwAONrKFgG4BBsfpEfTEZKUVJcnv6md4i1KKkuTHDQ8HYqxLTpybw/h+drMvKq0zC5RrX2ZtqsRe97b7R42OzjK8tqRp4ytGm5brU7X3t8TzMXmeX4CcYYmrGDlyu7X6CZUqRVqNNhir0ucpT55InJVbJO19tQF+Y5Rn4fF4TGQ14epGa7YtP4XMuhicPio6qE1Nf7Wn8GJ0ZhlBABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABAC1ScNYiryXFUOg1GsJb9dUnJrdSn2lItHl4vMsuwDSxVaFO/7UkvizAxGOwWDaWIqxhf8Aakl8TTqNMqVIqa5Kq0+Zpk4n1mJthTSx52UAbecZWHxOHxdJVcPNTi+sWmvai/Qr0MTT8ZRmpR7U017ia8g8GYSxtjuuSOKJJc+ZSSRMSjQm1NIV9k0rCkpsVc09bC/mCOYceZzm2SYGjVwE9OuTjJ6U3yurN3S69PgaDxhmeY5VhKVTCS06pNN2v0urN7Lr0H/n3lJSKLg2RxThCkNUyUkbMVOVlUWT2ZPcfPW4NkqJ6KB6RqXAfFmLxuMngMxqucp7wlJ736w7mt0vQzWuEOI8TisVLB46o5ue8G+d1zj61uu5kzZJpbp/CnglMy6LzQWWrA+s684pKfb08I5nxpqxPFOLcF5lr/8AGMU2aJxU5VuIcS4LzbX/AOMUmzlbiIoBo3EdN1BCQJasyzc6iwA74HZuD4oB/jR33wfY/wCmcOxovzqLcPV50fc7eo7FwXjFiskjSfOk3H1c17nb1HR+U9eRSuBim1llCXU0qXmlzCXLpFm31qctb9oSR52ji/FWBeK44qYaW3jXBK3+6CUf5rX9ByziLCPEcWzw728Y4Wt6YpL38/QbeLMEs1Pinyxx3IAuy3aLbnXEJ1JUEMLdl1kdAQSm/wC56xj5VnU8NwtmGVVdpWTivrTUZr1bO3eWcuzWdDh7G5dV2dk4rvkozXq527x64cr7dazSzEoLqtaKVPSsvpKiO45KpKtug1au8Od/KNZzHASweV4HFRW9WM5etTdt+623T1ngY7BywuX4TEx/+yMn61N237rbdDgzA1PcovGNhulEKbXJYpEsQUlBsh1SeXMbDl4GPrDO8RHGcH18Qt9dHV284p/E+jc2rRxXDNatzUqWr2pM7ZzIx1g/A05QZvFVAfqrkyl5MlMs09p/sbadadSyNJIINhzA35R8w8OZHnGdwrU8vrKCjpck5yje97O0U7233fI4DkeUZnm0asMHVUFG2pOTjfnZ7Le2/PkcX5tY9w9j7EtHnqDQXqH6JLuMPdqG0h4FYUghLewt3r333HhH0twnkWYZFhqtLF1lV1tNW1bbWe8t+w7zw5lGNyehUp4mqqmppq19trPdnW2VVWaoXA3Ra4+yuYYp9KmZlxpsgKWlDrqiBfa5t1j554pwksfxxWwsXZ1Jwim+SvGKuzivEOHli+LKmHi7Ocoxv2XUUJWE+IbD+LcxqNhuVw1UpOZqL/YtvvPslDZ0lVyAb/c9I9DNfB7j8qy6rjamIhKNNXaSld7pbX26mbmPBeNy3A1MVOtGSgr2Sld726kVcVG+YGDv3qf/AJ4Rv3gsVsvxX14/9TcfB/8AoWI+vH/qMnh2lVzPFLSnEpSpEtIzTy9R5Ds9AI87rEbT4QqsafC9SLfnSgv5r/BHv8a1FDh+af60oL33+wXOJ2ZW5n/TZcuhTcvQ2tKBbuFbjhPxsDvHl+DOnGOQ1J2s5VJb9tlFL2bnn8BU1HJ5ytu5v12SRm4bsFKrWZ7+LZxsmn0Swlr8nJpYOn/QSSr2lMW/CNnSwWWRy+m/Lr8/RBPf+J7dyZb44zX6LgFgoPyqvP0RXP2vb2nTuFcUVar8RGP6XNyU3JUemNSrVMD8qtCHyhS+1dSsix1FSbAH1QDHDc1yzCYTh7BV6c4yqVHNztJNq9tMWk7qyTv6bnJMwy/D4bJcJWhJSnUcnKzTte2lNc9kvbc4AzBpnzPntjCmBBQhisPhsFvR3VLK02HQWULeVo+ucgxP0vIsLWf61ON977pWe/etz6Tyav8AScow9V9YR9O6Vn8NzsnImVbwrwhzGIZpO0yqaqi7jm22kpT8Q19MfNfHNaWacXRwUH5uin65O798vccM4uqSzDiRYaH6uiC73u/+xs5X5ky2cuG67RMT4ZlAuUZbXMM3L0s825cCwX3kKBB6+YIMW+JuHKvB2Jo4rA4iVptpPlJONn02a3+xos5/kc+GK9LEYSs7SbSfKSas+a2af9mjjDGeGm6NnziDCdGS5MNsVYycilZ1LVqUAhJPU94C/W14+lcnzKWMyGjmGJsnKGuVuW17v3XO85ZjnicopYyvs3DVLs2vf4XJIzdydpmW2FaTU5TEL069OTAlzJTDCdWoIKnFpWm3dBHIpv3hvGl8J8X4niPF1aFSgoqC1ak3a17JNPq/Q+j2NU4b4mr55iKlKdFRUVfUm+V7JNPr6+hDVPoNbq0hOTVKo09U5WUA9KdlJRbqWb8tRSDaOk4jH4LCVIU69WMJT5KUkm+6/M3ytjMJh5xhWqRi5ck2lfuuJRBCiFApUDYgixEegmnujM5lIkBABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABABAAdk3Owte8OY5knf3pcWy2UVRxtWGWaHRZeWQ8yJpy781rICAhCb21FQ3UR7DaNGXFmU1c2hlmGbqVZNp6V5Mbc7t9lnyv3mpfhHls8yhl9BupUk2nZeTG173b7LclfvNrJrAknj7ORFNqhX8zSUsqcnUNr0qdSlSUpbvzAUpQuRvYHle8WOMc8q5Dk7rUPzk3pi3vZtNt96S29JZ4nzerk+WeNo/nJPTH0bNt+pLb0nSGY+eTGXWM2cG4Yw9KzQp7bYm0uqUywyCkKS02lHXSQSrkLjY7xxbh3gifEWDeZY6vJeMb02s5PezlJv08l17VscryPhOWd4V47F1WtbdrWcnvvKTfp5L3oebP5lM/eH9Lz8t6O6oqbGpQU/S5pI6LtuNwfBSVbi/LW5rNOA8/0xldKz7I1IP0dvTtjJHhT/wAQ4PznTGV0rP0Th3e7tTRy/kU7N4X4v2qHPgS8y63NUyaQVaR2iQVAC437zWw63Edy44hSzPhF4qluloqJ+h7eraW/Ydc4tjTx/DTxFPdLRNdz2+D3OwlVmSqGbmJMuq/pfZnqUidkW1gWellpLT7ftSpJUL72WfvY+dFg62HyihnOE2dObhJ9k09UJetO3Zdek4esLVo5bRzTDbOE3GT7JJ6ov1p27NvSRZj1ExlfwpYFlfS+2eoWIZOxSu3pDbTrrnvui1x0PsvG+ZFKlxPxVjJ6bKvSqf8AFyjFf9uRuGUOnn/EWKm42VanP1Nxivjy9Br8TNFaq2TtCxVJlK0U+bAKk2OpiYSLG/hqCD74u+DXGzwmb1svq7eMj/NB7+6/sLvAmKeGzOrg57a1/NDn7r+wvyYLVU4Fa/Tn2Sppv5zl1pCjdwKb19OXr293nFHGSnhuOaFaD3fiZd1nb7LlPFClh+LaVWL3fin3WdvsF/h9xvL1/IORptRnmmqlRdMm8HXQlSmbAtLNzv3bp/iR5PH2R1MDn869GDcK3lqyv5X6y29O/rPN4yyqeDziVWlF6KvlKy68pL27+sirKTMCkS3FDmXUaxV5WmUqsKdmGpiYmOyZKm5juW1dShe2/K8b9xZkGMq8MYCjhqTnUo6YtJXl5UN+XY12G5cR5NiKmQYKlQpuc6dk0ld7x35elEaYwqlCY43Hq7SKsw/Rfn+VnVT0su7abltTpCk8wDruRz3jdsowuOqcFLC4mk1V8VOGl8/1lHZ8rq23cbZluHxc+FFhq9Nqp4uUdL59VHZ9ux0zXs1shcTOywxBMsVtEqtapZM3R5hxDZVYKIGi24A3jiGA4V48y1S+hxdPXa+mpBN25dfScmwfD3F+AUvo0XDVa9pxV7cupz/mxiLKCtYPk5fAFIRS6tL1AKdcZo/oyH2dCge+Tci+kgWjrvCmXcXYPGTnm9XXTlHZOpqaldPly5XTdzpfDuC4lwuJlPMqmqDjteepp3XTuvcdFAzdwfTeDNeBplye+fzRpqUCUSRLXaOKcKe/fl3hc2jwsfwjnGJ4xWawUfFeMhLzt7RUb7W9DPHxnDeZ1+J1mMFHxeuEvO3srX29RCuWVdo+GM8sPV+vF9NNkHVurMs3rXq7NQR3eo1EX8o6bxLgcZmeR18HhLa6iSV3ZW1JvfuN8z7CYnH5TVw2Gtrmkt9la6vv3D1zyzAw9mBi3D05h1U0uXkpFxl4zUsWjqU4FCwJN9o1ngfIMwyDCV6eMSvOSa0u+yVjweE8mxuT4atTxVrzkmrO/JWLcg8QYbwvnLPVjE1Xao8sikuNS7j2rSta1ounugn1QT7onjzL8yzTJ4YbA0nUk5ptK10knvu11e5PGGCx2PyyNDCU3Nuabt0ST33a6iVnfXqZiPiLq1So001UKf6LLNNTDDgUh7S0LkH2qtvyIN4z+CcBist4ep0MTFwnqm2mrNXl19l/TczOFMJiMFklOjiIuMrybTW6u/7XOqJOq0jJ7g0lpiRmafU6kxLBQDMylxE3PPK726TcgG4Nj6rfSOC18Ji+MOMZQqxnCDfWLTjTitua2bXL0s47Vw+J4m4ocakZQg31TTjCPetm/izQyhzsq+YWPJjDtZpMjIuNyDky3MSr6xrKVpGns1k9FXuD0jK4t4JwnD+AjjMNVlJOSi1JLa6e91bquq6mVxLwrhslwaxVCpKSclGzS2unvdW6rsOeeIOnKk+KStLabF5+WlplATc6lKbCDe/UqR08o7H4P8Qq3C9JSf5tzi+5O/sszp3BlbxvD9NN+Y5R9jv8Gdf1KpYcyw4a6LLYlk1TNIYlJamvyrcul7tVLTZYKVWChfWTfw8Y+c8Nhcw4n4kq1MFLTUlKdRSb02Se26vbolb4HEKFDHZ/nlSWElacnKabbVkntur2fJL5EXtZ9ZTYUwvMsYLw1MIdWoqTKS9MTJtuLtspayb29xPgI3yXAvFea4qMszxCaX6zm5tLsSt8kbdLhDiPMcQpY+srL9Zycml2JW+SIcydk5/HvF+1iCqkPuMPu1ieWE93WDZtNug1qQB5Jjo/F9ahkPCLwlDZSSpR7bfrPvsnf0s3riapRyfhp4ajspJU493X3J37yWc0cOVnNniZkMIUtZlqHh6USqrVBSbolnH7LUAPunCgICU+0mwEc+4YzHB8KcNTzGur1cRJ6I9ZKGy7o3u2/Urs0rh/G4Xh3IZY6tvUrN6I9Wo7Luje7b9S3OhsMUbDeD8ECj0JLcpS6aVCZUlwKWFhIU4t1XVdrE38uQsI47meMzLOMd9Jxd5TqW07bWbtFRX7N9lb082cyx+Kx2ZYvx+Iu5ztbbazdkor9m/L19TzefareZ2etQXSpUztVrVQdeabB0pSgkkEk8kpQBcnoPdH2nCeC4ayOCxEtNOjBJvtfoXVt8l2+g+p4SwmQ5RBVpaYUopN+nu6tsmZ7hbxeijl5nEVHfnAgEyxQ8hOrqntCLe8jfyjm0PCflEq2mVCoo9vkvbt03v7zRY8f5a6umVGaj2+S/d/f2kI4qwJi3BU8lnElFfkELNmpkWcYd/cuJukny2PlHT8qz3Ks6hqwVVStzXKS74vf17o3/L83y7NI3wtRSa5rlJd6e/r5DRjYj2wgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgAgDcpxp4xDIGrB1VKEyj00Mr0udjqGvSbGx03tsYxcT9IeHmsPbxlnpurrVba67Lliv450ZKjbXZ6b7q9trrvOvM3sncNN5UYfqOBKYxJttTrLL7jKypU0xMqQ2hxS1E6iFKQbnayzyEfO3CXF+ZSzWvRzWo5Nxk0nyjKmm3FJcrpNWXVdpxHhvibHyzCrSzGbk3FtX/VlBNtJJdUmrLsFTiaqKaRk1hvC8qhTbD86krKUWQlqXRpSkkbC6lJsP2vlGD4NcO8XnGIx9R3cY9u95u7fa7JO79Ji8B0Xic0rYub3Ue3e83d9+yftIt4ZqlKSWfs/JTLgbeqNIW1K3NgpaHEuFPtKUqI9hjfPCXhqtfIYVYK6p1E33NON+67XtNv47oVKuTwqQV1Cab7mmr+1+8v4ksJzlLzi/NWhoqpFYZRqfAOlt9tIQpKj0ukJUOQO/gYjwc5tRxWT/QG/wApRb27Yybaa7bO6f8Aco4HzKlXy36E35dJvbti3dNd26fYP/hWlKknDmL51TZFHmJhhuWWRs48hK9ZT4gJUgHpfaNQ8KVXDvEYWlF/lIqTfoi2rX72m+7c1vwhVaDr4eCflxUr+iLta/e033ELTldZp/HpNV6XfC5VrGJV2qVhIKC92a9zsBYqBPheOl0cDUr8CRwk42k8Py576dS2XqN9pYSVbg9YaS3dHl6bXWy9RMWfuJpeg5u4AxVhusSU3W6Up9p6WZmkOEI1JVZaUm4SoKWk3PUbdY51wHltTHZRjcBjaUo0qulpuLW9mtm9m4tJr3mjcH4CeMy3F4PFU5KnU0tNprfdXTfNrZoY2dOcGHsw8F0mjUSnT7Po06Jp16bShKf0op0AAkndR3NuXnG08G8IZhw9jKuJxU4vVHSlG7/WTu7pLpy35mxcL8N43JcVUr4icXqjpSV31vfkl05DSqWdGJqlkZLYBckaeKWintyb8wtpTj7yUW0nchKCLJ3AJuL3jYMNwbluGzuWbRnLxjk5JXSim+a7Wt31XYe1Q4XwFDNpZkpS1uTklskm+fpfXquYyKXjbF9Dw6aTRcSVCkU0vqeUxJv9kCtQAUSRubgDYm20bRiskyjHYj6RiaEak7JXkr7Ldc9vtNgxGVZbi6/jsRRjOVkrtX2XLnt9o1iAo94BXtF4949hNrkViCAiQEAEAEAEAEAEAEAWhKQbhIB8hEtt82TdivRa5V8OYhZq1CqL1KqTQKUTDCgFAEWI3uCD4ER5+NwWEzHDvD4qCnB80+W3L2GFisJhsdQdHEQU4PoxYrGN8SYixfSK5iCeTWqhTUtpYXMMpAUltztAlYSBquom55m8ebhMky3L8JVwuDh4uFS7dm+bWm6ve1ly7DBw2U4HBYaph8LHRGpe9m+bVrq97bch85lZy1LMrB1KpU7RZekmUnVTLi5Z9S0ukoKUiyhdNrqPM3v5Rq3DfB2G4bxlSvSqueqKirpJre75OzvZdDXci4YoZHip1qdRz1RUd1a293uud7LoQzHSjfDtjhcoDUvgTEWJVJSqanJtMq31KGmhc+wKWr/yR8w+E/HTqY6hgl5sI6n6ZS29yXvOBcf42U8ZRwi5QWp98vkl7xZzVzcp+XSJvDuDpeXmcXTTy5icXp1olHHNytz795W1knYAC+1knzuFuE8RxFpxmZNxw8UoxXJyS6R7ILe76u9t7sweHuG6+duOKx8mqEUku2SXRdkVvd9d7dWbGOphzL3gRNMdecFZnJJuScdUu7jkzMkrmFk9Tu6SfqizkUI8Qcc+Pil4qEnNLooU9oJdi82xayiCzri7xqS8XGTkl0UYbQS/lsc+8O009JcRDTyKRNVCWckXJZ5+Wllu+hayNLitPqpJTpJPQ36GOv8AhCpQrcPOLqqElJSSbS12vdK/N73S7e86XxrTjVyVxdRRakpJNparXulfm97k947wzmtOcUuHqnQqzPy+EHXWGVrkJrQiRQN3+1bvZWrSTrIINwNrb8kyLM+FaPC9ejiqUXiEpPyldzf6umXNWv5t1azfU5xlOO4dpcP1qWJpxddKT8pXcn+rZ9LX5XVrNmjxOYqEhllTcKyzhRMVeZ7eYQDyl2Tex9rhR/omMvwaZX9IzOpj5ryaKsvry+Ub+1F/gLL/AB2PnjJq6pKy+tL5K/tIAymyjmMyjWZmYn3KPSZJAbRNNtBwuTCtwjSSLpCd1WN9wOsdc4r4tp8NqlCEFUqTd9LbVorrddW9l62dK4i4khkXi4RgpzlvZu1o9t+1vZesa+YOXdby5xRL06sPSs2iabU7KTEq4SHUJIBJSe8g3I2PuJj3sg4hwXEWFlXwycXFpSUlyb358n6vXY9fJs6wud4d1aCa0uzT6N+nk/vshhRthsgQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQBQmySeUAdWYD4eZZzCrOJcyKi5R5ItdsaalxLCm0dFPuq9S430jcbXIO0cDz3wg1Y4p4LJYKpK9tdnK77IRXPve3YrbnG8340qLEPCZVDXK9tVr3fZGK5979hCuZ0pguSzbmmsAzbU3h0sNlHYOLcQ25YhaQte6hcBVwSO9tHTeGa2c1sqjLNouNa7vdJNrmnZcuzt2N+yGpmlXLYvMotVbvnZNrpsuXZ0ZH0bebMegvD5itOJshW6RPOpmJ+iOiTdDtlFTHrMqI8ALp/+XHyB4QMreWZ68RRVoV1qVtvK5TXfff8A5HzRxnlzwGcOvTVo1VqVv2uUl9vrFGn5vYdrOdFWy3xBRHaROomlyjXp62npecUL90jkkqTYpBvfVa9+eJX4RzDB5NSzrB1VUi0pPSpRlFdq6vS/Ota1r8jFrcNY3DZXTzXDVFOLSk9N1KKfZ22fPla1+RAecGVVQwHixvHmB2lylFafQ+tEqDrpTwNwsD9aJtbok907ER1jhHimhnmEeU5o9VVpryuVSNuX1kvbzW9zo/DXENHN8M8tzB3qNNXf/wBkez6yXt5rdD0w9xMYfncMJksdUB8TZRpmHJJhExLTFuR7JagU3523AI2Ma3mHg1x9HFeNyqstPRSbjKP/ACS3t27M8HG8CY2jX8Zl1Vael24yX/JLfv2Y1sZ8R65zCb1CwJQ14dYW2WvTnihLjSDzDTaO6gnfck2vsAd497J/B0qWKWKzat41p30q7Tf+6Ut33dersexlnA6p4hYjMavjGnfSr2b/AN0nu+62/bY5a6W6R3g7AUAAFkgJHgBaHMm7ZWBBe024/MBlhtT7x5NtpKlH3DeJScnZbsonOFOOqbSXp2+JIFHykzPr/Zmk4Brk02u2lw09baDf9suwj2aOT5riPzVCT9TXxsatiuJ+HcH+exdNf8k37Fdkn0rhPzmqOlUzSKdREEc6hVWwofxUajGwUuD89q84KPfJfZc0/EeErhahfROU/qwfxdh+yXBVjJwJNSxxQJIfdBhh98j6EiPbp8CY9r8pWiu67+RrNbws5XH8zhqku9xXwuPGT4JaWjep5nPr8RJ0ZCPpW4Y9WHAUEvLxHsj82eDV8Lddv8lg0u+b+xIccrwZ5bNW9OxtX5g/936M1f8A8hjPhwLl68+rN+xfYzyKnhXzqXmUKa/if2oVmuEHJhtQDtdxFMeRqTSfqajJXA+ULnOb9a+Rgy8KXEj82FNf8X/UbY4SMjtwZ2vE+JrQ/q4vfgVkq6z/AIv7Fn8aHE/ZT/g/uUXwhZJOI+x1TEDW2xFWQr624pfBOTPk5r1r5FS8KPEy5xpv/g/6hNmODHKt1BMri/EMuehU/LuAfFofXGLLgbLH5tWa9nyM6HhWz2Pn0Kb9Ul//AEN2c4H6E4lRpmZs20fuRNUtpwfFK0x51TgOl+piH64r7Gj2KXhbxSf5XBxfdNr4pjNnuB7GCFK+asd0OdT9yJmUeZJ+BVHlVOBMcr+LrRfemvme/R8LOWS/PYaa7nF/GxH9X4RM6aYFqlaXTa62nrIVNAUf4rgSY8KtwhntLdQUl/tkvtsbRhvCTwtXspzlTf8Aui/jG5FdYydzVoOs1XL2uy7aebiJBTyP9JGoRr9bKM0w/wCdoSX/ABf2G44bifh7GW8Ti6bb6akn7HYjuYYflJkszbLko8DYtvtltQ9ygDHjtOLs9mbRCcKkdUGmu1O/wMUQVhAG9TqpUqPU0ztJqMzS5xJ7r8o+ppY96SIxcRhcNjKTpYimpxfSSTXvMevh6GJp+LrQU49jSa95lp9Uck8aSNamWk1R5ieRNutzS1ETCkrCyFq5nURuecWsRhY1sFPDQehSi4pxt5KatsuW3QorYeNXCyw8HoTi4q3RNW26bEwZnZsIzVZwtTVSacMsS0y45OuTDxdaStelIculOooSnUSNN9+sc54a4UfCrxNZS8c5JKNlZtK7tZu127b3tsaRkPDr4edeqpeNcklGys7K7tu7Xbt1sdFU3EOXWTvDU3M0CrSWI1L3aVLzCO2qk0oX72m5QAPEdxItz58dxOX8Q8X8SOGLpSpW53TtTguy+zb9HnS35cuXV8FnfE2euGJpyp253TtCK7L82/5nvyNrIzFWNscUTEOIsUTrLtOXOJl6ZLtSqWktqSLuFJAuUjUhPeJ3BjG44yvJMkr0MFgYNT0uU25Ntp7Rv0vs3skWuLcvyvKatHC4OLU1G8m223fZX6X2b2SOU8yqzO5l8UU61RkmeS5NopdIQjcLQhRSFbdCorWT4HyjvvDeDo8N8MQlifJtF1Jvsb3t3pWjbtOx5FhaWQ5BF4h6bJzn3ve3elZW7TuTDNKpOXmEsI4HkltvTj5WkqACVTCkILkxMEXvbkP4yB0j5azPFYriDF4nNKt1GNvTZN6YQ+31Nnz3j8Ric6xNfMKitFW9V3aEfv2NnM2c1ErWYfGLK4VoDAmJiSpLDbrik2blkqKnFuOKHJI1p877AEx2/g7G4Lh7hCWPxbspzk0usmrRSiu12fotu2jrPDGLwuS8MyxmJdlKcml1laySS7XZ+jqSTUeHDAgyzl5U1CZplVkpdSpiuA7OkXUpbrROnSN7AEEJAFzGl4bwi55/icp6FOnNq1Ps6JRkt7vre6b6I1Shxvm/09z0KUJtWh2dEotb37b3TfQ4Sc7NL7gbc7RoKOhy2nUm+yrdLjePquLk4rUrPs9PYfRMdTSurMtioqCACACACACACACACACACACACACACACACACALtPnEEXRQpPTeJF0UgLhAXCAuEBcIC4QFy3UIEag1CAuGoQFytxAXC8BcL+RgTcqN4EXJEylpspVeJTBkjPgKlFVFLi0kiyi2lTiUm/ipKRaNN4rxFbCcOYurS87Rbu1NRb9SbNY4jr1cPkeIqUvO029rSfubJ94p6jWEDClLSVooD6Hn3dKjpefSoABQ66Um4v1UT0jkvguw+Dl9JrtXqxcUvRFp7rvez7rHN/B/Rwzdes/zisl6Iu/Lvez7rHH+5j6L2O33KDfluIC5L+SWN2cE52y79RmUytCqLRlKi4sd1ses24fAJWBc+CjHO+NclnnWSyjRjqq03qiur6SXrXvSNJ4qyuWa5U40o3qQeqK7ejXrXvRsZ4YlwjivN9qtYSmHZgmUS1PzHo5abdcQe4tBNlE6bAkgeqLXixwVlubZVlDw2YRS8puKum0nzTtst90rvm7lrhTA5ll+WPD45W3bir3aT5p9Oe9rvmxoV3MfHOJaFLUys4lnZunssJa7AOdml0Dq5pt2ithcqve0bHgOHcky2vKvhqEYzk73tdr6t/NXoVj28JkmU4GtKtQoxUm73te31b+avQrDIt7fhG0Gw3CwAuTb2xIuSVhHJ3MvHDqPzOYOqM1LqP6rfZ9Hlx/8xywPuvHtYTKMzx7/wDj0ZNdtrL2uyNTzLifIcpT+lYiKfYnql7I3ftOksMcE2KJoodxljCm4fZPNintqm3vYVK0IH/mjesJwNjam+KqxguxeU/sXxOU5h4VsupXjgcPKo+2TUV7Fd/AnagcL2RmFm23qymZxZNJ3UuqTtmrj/u29KbeRvG7YTg7JsPZ1U6j/wBz29iscuzDwkcTY1tUZxox/wBi3/ild/AkuXrOVmCacqXw/SaRQ20ixElKttH3kC/xMblh8Fg8IrUKUY9ySObYvMMxzCWrFVpTf+6TYyq1nxhuWS4ETqXVD/vLge8xnptnmqKRFdS4lKfLqXomkAjok3iqzKrRGLP8UraQQ0+pVj0PleJ0MpbiMud4p5vcodWEkAg67Xv+VvbE+LZGpDamOKCrr1qS8sWuQdR3sbX84qVInUhGf4ma4olImFetYBRI6/i3h4sjUaSuJevJF/SnBv0VyvDxasNRanidxAkm027a+x1+O31w8WiFM2m+KevML3fcuLknUQU+P1Q8WTqFVni2rrCtK5hZ07E6r2+MR4sjV6B0U/jEqLWgvPHTqtckbkdPOI8Uyq8SRaRxkNKKRMrHmNYEUuEiLxZKdF4taBNBCX3EpJ6FQP4YptJC0R/DN/K/F8mGa5TKZVkLFlJnZZt3/WBjCrYXDYhWrU4y70mZ2GxmMwktWHqyg/8AbJr4DArmTvD7jJ5x+SpJw3Muf42jThZTf/Jm6PgBGqYrhLJMTuoOm/8Aa7e53R0HAeEDinAJRdZVYrpNavftL3kQ1/g+S4wt/BePmJva6ZWsSvZk+XatXHxRGmYrgSot8LXT9Elb3q/wOmYDwswbUcfhWvTTlf3St8SBMUZEZp4SQt6fwpMT8kkXM3SlCbat4nR3h70iNGxnD2cYHepRbXbHyl7vkdVy3jbhrNGo0sQoyf6s/Ifv295EbjbjUwtl1CmnkGym1pKVJ9oO4jWHs7M32M4zipRd0+zcs6wKropYatWkXPM23MOasL7WJswpnliXCmUkxhCVp0g7KiVdZkZoJU29LLcJJcNrhw3UTuBvbeOY5rwPlua5ssxqVJKWpOS2ako22XJx5enuNBzHhTA5jmSx05yUrpyWzUrW2XVcvSPLhpp+FkY3n6zVK1JtYhZbLFLkH3tC0pUn7I8NVgo27osSQNRIFxGt+EivmjwUMNQpSdGTvOSV1debHbdb77qz2seFx1XzCWEhQo05Ok3eUkrq/SO263332eyJUy1xI5mJxV4zxW1c0OkUxNMpG5sULe1KX4XX2ZUR4FPhGgcSZdHh7hbCYCX52tPxlTlzUbJdto6rd9zT88wSyXh7D4J/nKktc+9R2X/G9u+47cS16k4DxM9TKCy3UsxMYVNK2WnQCUlVm0OvaRcMtJT3U81aT4qUPByzA4vPcKq+Kbhg8JB3a9F24xvznNvd8ldehHiYHCYnN6Cq4l6cLho2bXo3ajf9aTe76behDcz8xOrCfD01h6XnHH6pWf0H2zm61spAL7h8Cq4T5a7DlHs8CZb/AIrxA8ZOCVOj5VlyUntBem3P1b8z1OD8Aswzl4mUbQpeVbopPzV6ufptuQTw+5dJxVmCvElWlA9QKQsFDbiLomZki6EW5EIHeI80jrHVeP8AiF5Xl/0LDytVqrmucYdX6HLkn3s6Jxlnf+H4P6JRdqlVc+sY9X6G+SfeNLOr8xzWelSlcHU9uQlZW7dRUwshhyZ1HWW08kBPqm1gVBW3jsHBn+MSyOnUzKblKW8L+coW2u+bb5q+6Vj2uF3mcsphPHz1OW8b81Hpd823z33tYjScptRpyJVVQkJmQTMtdrLGZl1N9sj75OoDUPMRu9HE4fEalRmpaXZ2adn2O3Jm2UsRQr6lSkpaXZ2adn2O3I0oybl+4QuLhEi4QFwgLhAXCAuERcXCJFwiLi4QuTcIXFwhcXCFyLhC4uELk3N0Jv4RFjH1Bo26RShqMDjW108/CLq5kN3MPZufe2irYpLg0sjnaIuhcu7BVhdULoXK9gfvjFNyu5XsduZibi5TsE+EQRdFwaTblAakHZJvyERuNSK9mPARJOouCQB6ogNQaR4CA1FCLchaA1G/SanOUTFVNrNOcDU/IzKJiXURcBSDcX8uh8jGHi8LRxuFqYasrwqJxfc/vcxcTRpYvDzoVd4zTT7mehak4Mz3yTba7XZWl1bbCwZmlzFrWII25kbiy0+3b45TzngTOnK3ak2vIqQ++/O8WfNC/wAT4SzXVbtV35s4/fftTI9pHDpgzC847W8Y4gVVqXLK1pam0Jk5YDp2ytRKvYCAfPlG4YvwiZzmlNYXLaHi5y2vG85X/wBqtt32bNmxPGuaY+Cw+CpaJy6q8pf8dtu+zfxOa806jg+r5y1GewTLGXpLiU9oUtBtp10CynGkWBQk7bHmbmwBtHbuFcNm+EyanSzSV6ivbe7Ueik7u7Xwsrto6nw/SzLDZZClj3ea5b3aXRN9X8FsR5p5dI3Q2i4afOKLEahz4ZwXirGVT9EwxQZutOg2Wphv7Gj904bJT7zHp4LLcdmE9GGpufdyXe+XvPDzLO8ryeGvHVo0/Q3u+6Ku37DqXCfCQ+EMzuY2LZaiMesun0yzjtuoLqrJH8UH2x03A8DTdp42rb/bHd+17exM4jmvhUpRvDLKDl/unsv4Vv7Wu4nqk0PITKxCZilYfkpmpMj9XVFXpLwI66nLgH9yBHRcFkGUYHelRTl2y8p+/wCxHF8z4s4hzdNYnEPS/wBWPkx9it72xLxLxSUeRSpqTdQbCyQDYeVrj8EbQlJml7czn/EPFZU5lTqJNxSTy53PwitU2NSRCVZz/wAS1Fbl59em/MGw+jwuPr6Rd8WiHIjGqZl1ubUvtZ1a9ibFfI7G1vZc3ipQSKXJjOnsVzjqwtyaVuk2Oq97W+nfl5GK0inUxCdr7i7hyY0EJJClcgdI6eFrKt4E+ESRcS3K3d0qLhs2QDdZTYAFVieu1/O4tAXNNNYaWGe2XqbKwFqKuadW+3TZXLxBgRcxitsplm1drpsO+QLAHcm5PsT8YDcsNbZUygkgKISkgHVp1J2O1+RJECDA5VWrC50gkC5N+g2HjbvQJuVFQaLSbqBWtOoeJuBf3Xv5wIMpnWVquFd4g2IV071jC9wCppotuWcTfVbboNyPdy+MAClIQQQoWKrC3U2/4++ABA1EgOhCdBJIudJsDb49Ym5Vcyomp5h4ht1wEbhOva9xt9I+MNiboWpXFuIJBzUxPLuk2J1n4wspdBqH/RM7cU0yYQFTLirWABVv5RbdNFalsTjhnioqcoptuamDYHckH8cWnSaKtW250hhbikps0lr0mZDZNtysA/XFu0luh5LW5I07X8qMyZRCMSUamVV1Q2ecbCX0+xxNlj4x42MyrL8wVsTSUn22s/atzYctzvN8plqwVeUPQnt/C7r3EUYk4Z8MVRLk3gTFK6Wsi6JGpjt2ifAOJstI9oVHO8dwPh53lg6ri+yW69q39x2XK/CnjKNoZlRVRftQ8mX8L8l+qxzhi3KrHeCkuPVygO/N6VWFQkyJiWPnrT6v8YCOZ5hkWaZZd16b0/tLePtXL12O3ZTxZkOdWjha61v9WXky9j5+psjwWIuLEeIjWzc7gQCOQPtEBqJEy/zNxHlxOTy6IiUm5Wc0malJxoqQtSQQlQUkhSSLnkbGNN4g4Zy7iOEFinKMoXtKL3SdrqzTTvbs27TWM4yPBZ3GKrtpxvZp7789ns+RLGQs9IVziBrWK8WV+XcxO8gop7E48EuvuO7KUjVt3UDQlI5BWw2jn3HlDEYHh+ll+X0GqEd5OK2SjyTt2vym3ztzNM4up1sLk1PBYKk1RXnNLZKPJO3a92+1DTzSqdRzQ4rDQ6EDNNMPilU0BWpvuqPau7ck6tSifvUCNg4XwuH4Y4V+lYvyXJeMn0e68mPfayS7WezkFGjkPD/0ivs2tcu3deTHvtZJdrOtXsPVPBWQ8lg/L2RS9WHGzLtTjqtDTK1D7NNuq8dyUp3JOkAWSY+eIZjhs6z2eY5xO1NPU4rdtLzacV2dG9kldt3ZxqOMoZpm0sdmUrQTu0t20vNhFfF8krvqNbA2SeCsF1Onu1t9vE2K5gKUyudALepPeUtpk3vbqtdzc9CQI9/O+NM6zqlUWEi6OHja+nnZ7JSmrc+kVZd6R62a8U5pmdOUaCdKiuennbklKW3sVvWhJ4kcWUunZXsYWXKy0/W6moLaD7YWqSZSe88kn1FEgISf3R6R6Hg3ynFYjM3j1KUaVLnZtKcnyi+1JPU/V2mZwTl+Iq5g8Wm404c7bam+UX2pc36u04Wt+1+EfVh9CqQBO/K0BcvAFuUQRqCw8IkaitvKA1FLDwgNQEAwI1FNIgNQafCBOopp9hgNRYdjum0CdRTUny+MVWZTrLdSbROkay3WmJ0jWUKx0hYjWU7QeH0xNiNYp9QIt2LWouikagKfERJGoqEC0BqK6RbleAug0j8hAakUKYDUW6QOkBqCwgNQaRAnUU0iA1BaBF0GkwJ1FNPsgNTDT7Imw1MNJIg9hqNqTnZ6nTqZmnzj8hMgWD0s+ppYHhqSQYx62HoYmHi60FOPZJJr2O5ZqU6VaOirFSXY0mvYzZqFXrFWQ2mq1adqaWzdAm5tx4J9gUTaLWHwWDwjf0elGF/2YpfBItUcPhsO34mnGN+xJfBCZp3jNsZWoe+Ecu8WY0mwmi01XogPfnpn7HLo/jH1j5JBMbFluRZlmjvQh5P7T2j7evquadnXFWTZErYqpefSEfKl7OnfJo6dw1krl3g+XaqGNqgMR1FACjLKPZyqDz3RzUPNRt5R1zLuDsvwtp4l+Nn2co+zm/W7eg+eM58I+b49ungl4im+q3m++XJf8V6xy17iAw7hik/N2HZdiQlm02bZlmg2lPXltb22MdGp0lTgoU0oxXRbL2HHKtapWqOpVk5SfNt3b9bOacVcQmIaw44lmaWgLJ0lC9IP9vT8UZKplrUyDKtjqr1B1S3p91ZJPduSQB5Xi8oRRRdjMmq8SpfaTGoBOxvcK32V7CCN4uEN3G7PVttpYHaEgq0gXuSN/wC21/AeMCkbj2KG0hTiVlXquJuLa9tviL+4QAhzOJfsRT2pIFxcG97AIPtPW/gYE2YjTWJXlObKA5gW5Db4fdHpAgTlV1wu6g9YAWAB9oN7e36BAk0Hq4pagrtCBpANzYDc8vcYi9uZNjXcrStGzlyoEFRPLoPh+GDuLGM1y8wVdrcg32Pna487dYkWMXz0Oz0lw6AbnfaI6CxcK0kgAulW3j4w6CxmTXToB7Q7WGx8PbDcWM6a4AhKe02AG3jE7CxtIroUsKK7nn+XxiLdotuKLNc1OBalG45bg+e8SRZimzX06VXJ0quL+R28fd8YECkxWmnZi9yTqKlHUTck26bc/qgDfZn2lo1KOkXAPIbG/wCC+8Ab6ewcU4bpAuVBJHLcW9nXaHMGsWNQLhUoXHMH8vj7YFVy1t+dlV9oy+pBvYnV4eYgLjnpWYmIaOsaJtekK2BNwfjFOlNFVyccKcRtWpzzaZp9yw+n39IsumivUdQYS4lJCeZSzPOjvJssWuLeBHUe2LTi1sTdc+wV6zh7KvMRlybYl26FVV7+lU3S2Cf2zfqK+APnGmZjwxlWYXlo8XPtjt7VyfuOjZPxvn+T2gqnjaa/Vnd+x+cvbb0ED4nynxJh5Dk1KBFfpid+3kge0SPFTfMe0XEclzHhPM8CnOmvGwXWPP1x5+y59CZN4QMkzVqnWfiKj6Sfkt+iXL22IwIIUQRYg2IjRdzqammrop+O8BqJGywx3L5e5kmuTNFRWW3GCwv7JpeZSo95TRO1zyNxuNriNK4oyGfEOW/RadV02nfleLa5KS527Lcn0ZrGe5VLOMF9HjU0Wd+1O3Rrn3W5E8Y14mGfm8ymBKe4H1JuupVRkANbb6Grm5Hio28jHJMk8GU1U8Zm1RW/Yg+ffK2yfYlf0o5/lnBMtevMJ7L9WL598vsW/pRIGW1PewnlVVszcwai/M4gqUp6XOzM0vUuWlB3m2UjkkquFaQBupIttGo8SYiGa5rSyLJ4JUactMVFWUp8pSfbbdXe9k31NdzqtHMMfDK8tglTg9MUuTlycn223V30TfU4mxhiioY0zGqeI6ldD0059iZ1XEu0NkNDySNvM3PWPqLJ8qw+TZbTwVDlFbv9pvnL1v3WXQ7pluCo5ZgoYalyiufa+rfexs23vHtWPW1FwF+sVEaiumBOorbximw1FdPuhYnUV0mIsNQaTCw1FdJhYaimkxA1FNJv/bFVhqAouOULC5jLCVcxFSbIuYlSu/dMVXKTEqXdHIAxN0Uu5hUlxPNB+EV7FF5GPWfvYWQ1MW2xqUVdOkW2rFGo2ABblFuw1FbAHlCw1BbyhYagtbpCw1BYdRCw1FLeQhYagIibIailjCyJ1FLHwibDUUtv/bCw1AR0hYjUW6RCw1BpELDUGmJsRqZXTCxOotIsIiw1CzRMPVfEVUEpSJNUyu/2Rw7NtjxUrkPrj2cvyrHZpU0YaF0ub6Lvf3foNezbPssySj4zGVNLfKK3k+6PP1uy9JPVBy+wfhNhNSxZNNVqdbAV2CjpYQedtPNXtPwjs+WcIYDB2nifys/ZFerr6/YfNueeEPNMxvSwX5Cn6Heb75cl3L2lMW5/ydOkDIUJKGJdtOlsICQAPYNgBbwjo0aeyS2SOPSm5Scm7tnNeIMy69XH1rcmlhsqUU8rbetbwt162jJjTSLLluRxN1dXoqn35gptYrNt7LTdOw5nbkPERd2XIpY35zELTCllbgISCpYCtrE6dr+HO525jwgBpzuKQlLzfaAvbDUN7LSfpCtR91vCAGpNYlcUrQFKLVgAjlZPMfQT8BAlIb8zXXnEFJcO53tyO5J93eMCqyEJ2rFK1kL2I23/AC9kSxZCY/WUJWSXLHx5D8t4gkS3q4ASoK8vy+iAE12trKbhQA69fbAGBVZcITZW/SxgDWVV3V8nDfxEQDGqpOi41EeNjAGI1J4d0KNgbc+sSATUXeqlXHMHpEWQM6Z5+wsu1uVuZiQXCfftfWVG2+/SAMyKs+kpCVGx29sAbiK0+OZvvsOkCOhvM18hW6iLcgDa0CRXYxF9kSkuFQuAQelvKI6gXWMRjuqUvVZQJ3uPp+ESRZDglsSIUEBawSDfcixN77+PO8RcpsOCWrTDwSVOJUkDkQQNum35C8Q7AXEzjS2yjtEkJBNybEk+A8L8oqZBsONtrZtYlJVYJA3I6c/fAGg7IEFOgDdPRX5eAgTdmuiYn5N5KmXFAggi0RZE3HrQs0K3SX0ATSwAd7KihxRVc6LwhxBuBKGZ9ZI69/cRZcGndE32JPmn8EY8aL6FIlKosX9JYASsn9skbK+vzjU804ey3M7yqR0z/ajs/X0frN8yTi/OcjahRnrpr9SW8fV1j6vYRnXML1OhqU44kTkiOUyyNv4w5p+qOK5rwzmGWXnbXT/aj071zXwPpbIuNcozu1PV4qq/1JPn9WXJ92z9A2gQfCNOsdE1MvQpTbqXEKKVpUFJUOhBuD8YhwUk0+TIb1Kz5MlXGucWKsdZc07D9WDDKWXy7OPyqSj00gDs9aeSdJ1E22JINhaOfZJwbleRZjUxmHu9StFS30X86z9Oy33Sur7mo5bw9gcrxk8RSu7qyT/V7bPrfa3VIiTfxjomk3DUVHOI0kai8DboYiw1FwG/hCxOousL8rxFhqLtPkIWGouCbiKSdRUI8vpibDUVsb8ogaw0mA1hp9kQNZTREjUU0RNmNQaIWZGoppIMLE6gKL8xEDUW9kn72JuyNRmaSEoHsi5JbmLqNi3KKLE6g07wsRqKaTCw1FdJhYag0mFhqLSDblE2J1FLeJhZDWWQsRqC20NI1BaJ07jUUKdrxVYai02ttDSxqAAnlCwcwNh1vCzGu5YCpaglA1KJ2CRcmL1KjUrTUIJuT5JbssVcRSoU5VaslGMd227Jd7HzScLyrbQncRTAYlxv6OldlH90ekdayng1bVcwf/BP/s/sXtOAZ/4RudDKF/8A9Gv+sftfsN2tZs0+hUo0vDzDbCUd1KWkWAJFtvG9vC8deo4eFGmqdKKjFcklZHAK+Ir4qtKtXk5zlzbd2/WyDq3jWuV55x2Zmlhu1xvta9tt/HY/gjMUEuZiNjUmJptrdbhL3S5uFWuQQf3IN/YPGLmxQ2xp1PFDDKFdk7pKgkar2PK4v/pW1c+XnAhLcZFSxOtbyQ24krC1lOk3tc3KfDYDn5qt0gV2GfMV1xatHaBKBaxvyAuB79+Z8oE2EGYqlkd5y/tPI23P0RD5E2EOYrSEpVZVx4/REiwjzNeVdZKrj2xG5Ihv1V1YUEG9+cSDVcnnDr1OabcyTAGmqfb1BOsurWkrCUi5CfvvZe+8OhDdnZi7TcO4sriGk0jDFTnFPJu0fRShJAF9RUqwAta1zueUefVx+BofnasY98kevh8qzPF/mKE5d0X8rDzk8nMy5lpBRQ25fTslUzNoaKjtvbmAPE77co8OrxLktL/7r9yb+w2ehwXxLX38Rp+s0vtuOljh7xiVBL1YpjCQLrKVqJUb+qnY27vU336R5MuMcqXmxm/Ul9p7tPwd57Lz504/8m/ghRZ4dK8thCprF8ky8VHtUsyilpQm+wSTa5ttc+e0YcuNcGn5NGT9aXzPTh4Nse1eeJgvVJm61w4O3Kn8YghIHZpRJq3N7kqOrfwsLDaMd8bU77Yd/wAS+Rlx8GlW3lYpeqD+Znb4cUICSvGTjp0/ZP0FpKzY2A3OkX35GKFxvHrh3/F/Yrfg0l0xa/gf9Rqq4dKkGSWcZsF4k6S5JEoR4bA3PU3vF5cbYe+9CXtXyMd+DTFW2xUf4X8zUmuHrEqZlYksTSL0uPVLzKkLUbjnYEAWvyv0jLjxpl7XlUpr2P7TBn4N81T8itTf8S+xiM9kVmHLtJU2ukTjilFOhqbUkNpv6xKk790DYDnGdT4uyafnOUe+PybPLq+D/iKHmqEu6a+2w3JzLHMSnsurmMMPuoa9Uyqg/wBptc6Qm9rWtdVtyI9eln+TVvNrxXfdfE1+vwpxFhvPwsmvRZ/BsaszTKzTbio0adlHQFEoVLrNkgAlRIFrb253uOW0e5Sr0K35ual3NP4Gs1sLicP+epyj3pr4o1O2AdWkXum+tQvpBBsd+XPbnz2jIs0zE58jaYm121NOWSOoN4gCk1UXkKuokk+cALMrXCgjvC4t5fTDYDkk8RWNi5YHci14blLQ7pPEaVKSldh4AgAX8ecU9NyLbDtkquy42CF9oSOo2t02679fZBECjpaW0LAKDgP8boCfp90TuBOmJAK0lIuLXJIt7foiQ0IqpeYlVhTalJA+6G35GBNxw0bGdWpUyk+kK0gi9zFLimT0OgsMZzh5lEvPKCkkWUFpvcG35bxacOwqTHXNKpFWbM3SFpZdVuWSbJV428PqjnWb8KYPHN1cP+Tqfyt+ldO9ew65w/x7mGV6aGMvWpLt8+Pc+vc/ahA1lK1oUCladlJIsRHE8dl2Ly+v4rEQ0v3PufU+mMszfAZvh1XwdRSj17U+xrmmXg3HP2x5ulnsaitvOFhqKWMLDUiovtEWGsyAQsVai8Xv4xDQ1F8U6WTqLwNoixTqLgNognWABgNZfo3iLDUX6fCIsTrK6NoWI1GPs4qJ1BogRqZQohYaimjb+yFhqDQfyEBqKoTsNov2MPUZbeURpJ1FbG0RYagsYWGorYwsNQG/gIWGothYai223nFVkNRbY2hZDUUNx7IWQ1FhNhuYmxGosJ32MTYai0kDrCzI1GIuhJIG0VqJOssQouuFCLFXM78h4mNiyvJMZmtS1FWiucnyXzfoRqWecSZdkNG9eV5teTBec/kvS/UbTuIqVhyTU6FpfnuQVa997beH1x3jKskwWVQtRV5vnJ838l6F6z5Xz3iXMs/q/l5aaa5QXmr5v0v1WI6q+Ma1W3VpbecSzfupBO/kPGNnUEuZp7faICglplTzzgcWNuRJCiTYkX8B052PW0XPQQ7jfqWI2GC420pIVqVYBewugbX/AGyQLHxvEAjSq4rU4tRZdF1DX3dklVyR7rkiw6WgSkMybqi3ZhRCzoPQm2w5fWfZyiSqyEaYqSUpOpe46+NtuUU3JG5OVoJBsdr7kHbwMLMDffqrjzo79iobgHx52/LpCyAmOzgQ04466AkDcqNgN/y+ESBVo2HsU4qmP/V2gT1SbCLrdDeloX3SCtRAv7+u9o83FZhgsEvy9RR9e/s5ns4HKcyzJ2wlGU/Slt7XsTBRuHvEM0wyrENflaSlXedZlEF91PKyLmyR1ubnpaNLxXF+Ep7Yem5+l7L5nSMF4Pcxq74urGmuxeU/sXvJRpGReXtNAVPy01iF8r1LM6+Q2d7hOhNhpHhvfreNRxHFWbVtqbUF6Fd+13N/wnAuQYezrKVV/wC52XsVviSZTKDhyiIUKNQKfTSoAKUxKpCiByBVa9h7Y1bEYzG4p3rVZS72/hyN4wmX5ZgVbDUIQ7oq/t5+8XDNOEWLht4XjzvFx7D2HWl2lnaknck++J0kayvbD8jDSPGFwWtxQS2gk+AF4abBTbNxEhUXEgiWcCfEi31xbcqa5suJTfQyfNk790Ep9rginxlPoyrTMtNNnbXCAr2LENdMjTMwLlpxr12VgeNouLQ+pS9a5o1i8pJsdvKK9KKPGNFRMKSb6jf2xDgQqr6FypouN6Hgl5B5pcGoH3GChpd1sTKrrjpluvTuNyqYUwdXEp+dcNyM0pJBQosgFJBuCLct9/CPaw+bZthdqdeVuxu699zWsVkGQ41t1sNC/alpftjYjms5G4RqDK1UqdmqLMWOhV+1Sg72skkC1zci2/lG2YbjDH09sRTjP0ryX9q9xouM8HuVVnfC1ZU32O0l9j95HFWyOxZTkqcpU6zWmQ3yA+yFW1tu6LHvHqRy35xt+F4ryuvtVvTfpV17V8jn2N4DzzC+VR01V/tdn7Hb3EZ1CiV2jzLjVSprzTiVpQG0oUty6iQnugX3038LfCNxoV6GKjqozUl6Hc51icLicFU8Xiabg/SrGg1MqSvuKIPPfY+RIMZBiioxPvIVckjzJEQByyNfW0tF1qFvE7H8vKIaA/qfiUOoS24uydOkkrINuvsvy98UvZFLSHxK1Fp9sqUsC4JUbEWPQb9Bf6hEq1ik3nGWZlBsNiSLWuQNybn2/VFQEibpNwopR3iom4H5dLe8wA3XGX5d66Dt+15wJ5Dko2MJ+lvhPaKKPb+D8ERZMglum4ylqwy2JhwIfA7rgPeH4/ZHnYvA4bHUXRxEVKPp6elPoz1MvzHG5XiFiMJNwkuzquxrqvQxyM1JBcS26QnUbNuD1Fnwv0Pl8I4ZnXDGIy69aj5dL3x7+1eles+n+HONsHnFsPibU6/8svqvo/8Aa/UxUS6NwbxobidS1GdKgRsYptYaip5ecLDUCVd7zhYnUZQfdEaRqLwRfeI0sajKPKKHEai8bDlFNidRkA284WI1F4G+4iLMnUZQkW25RTYamXafKFkNQKRtbnBKw1GG2+wiqzGou0722iBqLFlKATEpNjUaBnWgogq3EXdDI1icmfnE/wDs5MZrox7TB1szorGlQD7Km/MiKHQfQeMFZibl30goUB5XjHlCUeZcU0zdCLi43EWydSK9kYE6kWFo2gRqMRSQYqSGosO3SJ03GoxKPwidJGowqWLeMVKJGowlV1HpFWkajGp1KdhziVBsjWaynha/MRd0DWIU5VEJJQ0tIIJ1OE7DyHjHR8j4XnjLV8XeNPouTl8l737zkHEvG9PL9WFy9qdXk5c4x+cvcuvYNmaxI8losSWrvbFQ31HxvHaqNClQpqnTWmK5Jcj5sxGIrYqtKtXk5Slu292xKbl3X3PSZ9wlu5K78wB6x87c/GMpJIxuphqFTlaYhdraki6gFCx03BHhqFgq/W4iOYe5GFbxW6A62l0NrS3o1IJuCk3sk9N7fE+ECSN56ruPvKBVdAJAAVsB96PIdIFdkN2YqA1Fwrus7k+PnAkbk3WtIKAq21iPYd/wRT1A35iouuA6lk2O++8VATUrdm6o3JSrLs9OPD7Ewy2XFr9iU3J/tiic4U46puyXVl2nTqVZqFOLbfRK7JgwzkdjCtNsTNefbwrIq7ym1gOTZHTuDZJ/dH3RpON4owOHvGgvGS9G0fb8jpGW8E5ni7TxLVGPp3l/D09bJ8w3lJgLDTqJhNJ+e6iFa/TKqrt1BXQpR6ibdLD3xz3GZ9mmMvFz0R7I7e/n7zreX8LZHlzUlT8ZNfrT39i5L2PvJOD1m0oSNLafVSkWA9gjWHG7u92btGSjHStl6A7SGknWU7SGkjWXa/dEaUNYazE6RrNyRkp2pTYZkmFPK+6IGyR4k9ItzcKcdUnYrjqm9kLhkqRS1aZ+ZNSmx/7PLHuDyKusYqlVrbU1ZdrMm1OHnPcwOV19AKJOXZp7fQIRdXxi8sG271HcqdZrkrCa5OzLyruzDrh63XaMqOFpR5Io8Y31MfapJF0EnzWYv+Ij2EaivapChZBHsWRDxEewnUZETr7Zu2+6jyK7iLUsNTfQnxkl1NlM/wBtZEzLNzQ8UjSuMd4Wcd4Mnxl+aKGUlplREk8UO/rL2x9xi1qlD84ilxjLzXuJTyHZd4tvIU2sdDF9KMldGNJuLszF2g8fpirSUaw7XzhpGsuDx1bExGgq8YXvOompRTE6w3OMKBSUPJ1Cx5iKqbqUZaqUnF+h2KKqo4iGitFTXY0mveRxXMqsIVpLzso0qizi0aQ4yhKkpOkIBFwVJskACxt5XjdMHxRmeGaVa1SPp2ftX2o5zmHBGS4y8sNejL0bx/hf2NEN17KLFNFQHpAJqkruVdkpS1cyeZAGydPPmb78r9BwPEeWY1qLlol2S+x8jkuZ8IZzlqc1HxsO2G/tXP4kZlbku4j0lhyUWQAhLybXKhqA9trGx38o2znujQ3tzNxmbdadR3lXvexJ2gB10/ELja0hSibbd9Z29kLEWJHpeJUOBrU4VnYBKiAAR+Xs98U23IsPeVnGpqXSVOAgjmeovfb2m/uTEJixV+QS83sASTt43I5e4b7xWQNacphbSCkXubjz8/Z+KBAkNvzUk6C2spI33F/fEgfdHxTqQiXmiVIV3Sk8vpihonkSNTa92TaAtwzMn43utv8A/cn6R5xy/O+FoV718CrS6x6Pu7H6OR23hrjmphtOEzNuUOSnzcfrdq9PNdbjzZmm3GkrbWlxtQuhSTcEe2OOToyhJxkrNc0+aPoenWp1YKcJJp7prk12pm4lxKk87GLGmxd1lwIvtzhpGoyBfOI0jUjIlQJ32imzJ1GZKgN4iw1GUKvFOknUZgb7xTpGozCKbDUXgbxFidRfEWJ1htaFiNRjtYxVYaihsBc2hpGoRKpN9jIOK5G20ZNKnqkW5zsrjAM24VE6zuY9fxaMDx0hSpK3pqnz32dYmWgCnfpCrFQa22ManUcovtRrN1+ZZe0TKQ+i+4UIl4aL80pWJlF2YvSxYnpczFNcLT6fWa6GMaUZQdprYy4zU1eI4qRUS+A053VXsoeBjDq0kt0XY1LjnCN94xGtivUYnAAIJE6hOdI1GLyiRrNVa7DnFaiUuRrLdFucVqI1GupwDfpFWgpczUXMWNgYuKBGs03JkJSpSlBKQLknYARdjTcmkkUSqqCbk7JDGq2JEu65eVXpYtZbm4K/Z4COwZFwyqNsTjVeXSPRel9r9HJHz9xNxpPEasHl0rQ5Sn1foj2LtfN9LDaD0zPPBtBKGug8PZHUEupxYXWpJmSlFvPWDoAJSeZNwQPeNXkbQdiBp1jEjTLjjMs7cAjQfHcWv5WCSCep8IpBEFYxG5MruFGy99+VzyJ8LgJ2gVpIY81UFOOKWt03USST5nnAqG1OVYNE2UNR6eA/HEdQNiYqbrilJSuw6WPX/jEgSw47MT8vLyrbk5NvL0tS7DZWtZ6gAbnmD7oonKMIuUnZIrhCdSahBXb5JcybsJ5IVqrL9MxhNHD9NUbiRlyFTbib8lK9Vu/vPkI0TH8TUaXkYVa32/q/N+5HUMq4LxWItUx78XH9lec/sXvZ0nh7DWHMKyimcP0pmQUpIS4+BqecAFhqWe8fZy8o5vi8ZjMdPViJuXo6ezkdjwGXZflcdOEpqPa+bfe+Y4O1J5k38487QexrKdqLc4aCNYdr74aGT4wO18xDSNZUO36w0k6y4q8TEaSdbHVRcPiZppq9WfNPoqD+mkd54/eoHX2xh1quh6IK8n0+Zk04alqlyM9QxCHZP0GlNfNNJGwQ3+mPeZPWJpYJyeus7svOsrWjsviNztSSUtp0g+BuT7THsKnZbIsqT6Gd5hcuhlT6koS60HEWN7g/8DEpRK7pczerEvLU6qNJYK3pd6WbfZUv7pK03+u4izCpqjdre7XsYlUjEsamZJeMGezbSJFU2mwXsNBUOfuihyn4t9tvfYp8duXzMzIt40mAptKpBM4oHs9wUBR5eVoKU/FLtt77B1tytIYl6lWXG3tbMu2w4+6pBvpShJP4hEzqaY3S32W/eVRqKT3NBlpUyHSysENtFxeo2sBb8YHti+1FsjVfkywzC9QS8NYTyN7KHsMUypNrdEOb6iimeacY7GdvNyvRy1nGo86eGlDyqfsLnjYtWnuhMn5FyTAebV28ov1HR9R8DCnJT25MxqkXDdboS+03i/pLGsr2tusNJOsqHh4w0EeMLg6D91DSTrMyJlaB3Vc+cUOmmVqq11NB6iYfqNUM9NSaZSpkH9Fy40lVxY60+qu42uRcDkRHs4LNcyy1rxM7xX6r3X9jWszyLKM3TeIp2m/1o7S+T9aZBeKsn5qmSczUqA92kglepMuywpxWkquq5U4T3Ra1ha1/KOn5fxLgsZaFb8nP3e3p6/acWzXg3MsAnUw78dTXVecu+PX1ewiB+Xm5BSPT2RKaidBLyVJXte6VAm48/wC2Nz6XRzq+9jdlZ52XWNC9O3s2/LrEEj+o2J1IdAUsC9gQQTt093l7IhrYEoU2stzTCApQtytrHevzHLcnr06CKe8pY4VMomkqPaJWSL6ibAm/Mjw52H4TEpoiw3Zyka2VqCdO2oE8/wArWJ9oEVDkM91h1lZUm4INgQekBYVKdXnpR9KHXDouBzJiNmQSRRsQKYUFy57aXUbuy97XJ6pvyV5cj5c40/Osio5nHxkPJqrr0fol8+h0LhzinE5JNUqnl0Hzj1j6Y/auT7yS5OosTUqh9hwONL5KHlzBHQjwjhmIwtbDVZUqsdMo819/cfT2FxuHxlCNahJShLk19+faugopfBTbpGFoMzWZg6DveIcRrMocHO/0xGknWZA5t/bFOgnWbCHAR4RS4E6zZQvcXMW3EnUjMFi/OKdJOsyhYAERpGsr2g5kxGhk6y3tb3sd/GJ0kay1SwTEqI1mJbgCSfKKlEahm4gmLSyUA8zHpYeG9zDrVPJGV22/OPR0HnaxYkZoSGLUhZs0+C2sfVFE4a6XcRGooVe8tq8qG1uOAHY8h4RNJ32FW3MwYYmXPzVMpbJso2UIqxME6d2W8PUfjNiTES2jFDgbFgSCbeMePzpnq33HkNmhcb25mMBor1Gk+4E3i4okahFddF+cZCiRrNFx24O8VqJTrNNb4F7mwi4oEajRcmAbm+3XeLigU6xOem0IbUtawhCRcqPICMiFKU5KMVdvkixUrwpxc5uyW7b5JEcVrEbk48qWlSpMsDbbYr8z+L8h2fI8ghgUq9dXq+6Pd6e1+w+c+JuKqmaSeFwr00Vz7Z9/+3sXXmzXp9LmZt4KcQoIve1jex6xvlkcyHQtUrRpAKITfe5PhYd4e/Y+3e0UtgjDE2KwlbrbaraHAE2PIXNuXUA3F/HeIISZDtTq7j6lJK7JvYJTy5W/EYFxchoTlQShKgVaj0vC/QkaU7V1FZ0LG4vYeB3gBtzE0pbannHLBIKjqNrwBIGDstMR4yLM73sP0I7qnppnvvDwab21bb6jZPmY1rMc6w2BThHyp9i6d76d3M3HKeHMbmlqkvydP9p9fqrr38jqXCOCsM4Jp5bocl+jFps/UJghyZe8br+5H7VNhHLsbj8Xj5XrPbolyXq6+s7flmVZflULYePlPnJ7yfr6L0IeAeO/ejynE97WU7XfneI0jWZAsnrCxOovvtziLE6i4k9ntvtC25VcohYBINoOJCkXB1IMNJOseWGqLLTUpMV2tKLFAkz397GYXzDafwnpGBiKsoWhDeT93pMyjFSWuXJGhXcQzNcqSVqAl5JoaZWVbFkNJHLaMjDYRUld7yfNipWc3tsuhpy8qt+nzUz2iR6OkLWgnvlF7FQ8QNr+32x6ehRa1dSE+rFA1CRmcAqlVFMrUZN8KliEbzDa/XSSOqTYgnpGO9fjrx5Nexr5h1k42Qgl1xaW0rcKkoBCQTfSCbm3virxb5ss6m+Ze5MOuhsOuqcDaNDepV9KRyA8BEqmuiJ1XJDw3helVDD9Pmag6vt515wNtpm0MkIQbakpIJXc35eEYNarUpykoLlbo3u+l+hfja1yycw/RJWTq0mEzhqEjTkzS5pTieyKlaSEaLX+6A584uRnUm4ystMm1br13v6ip6RhoccbSvsnFNa0FK9KiNQPMHyjMdKL6FjUjDqcQlYQshKhZQBtcXvv47xT4rqim7QtipSkvgT0RH2eozczeZKkfpLaPUSk+KiSTbwi3aoqt5ckve+fs6FfjrRszRdZUzIS0yl1JL6SpLYPeSm9rq9pvYeXsjJUVO7j0J1XV0XyNS9GKmH09tJuCzjZ394jArYbV5UdpIqhW07Pka9RkBKTKHWVlyTe3ZWP9U+cW6cta35rmWqkVB3XJ8hMOodYvWLFzGVG3OJsU6imsjraJsNRXtiOZhpI1lQ+NNtVjEaCfGGVucdadC23dJTy3ilwT5lSquL2EisUGh4il3u3QKZUHE/qlhAKSrmFKbPdKgdwoAKHjHuYDNsflrSg9UP2X9j5o1jNchyvOLyqR0VP2o7e1cn99yBsRZd1OkTy1NNBLCu+Jlc2XJRW5KglejUggaVaXN9yE3sI6vl+cYLMVaD0z/ZfP+/qOF5tkGYZRK9VaqfSUeXr7H6H6hgqLkrUHmFakTDSrKQoEbdDvbY8wTz9ke87rmawOOmV16Xf/TCByNvP6opI5ku0PE7b6UNFdjtqItbbkANr9T5nyEW2iSQWlMTiNATpQRbdV9t7XPt3O3Q+MSmyGIlQpaXG1rSm7dibkeY/L8jFZQMaekFNuqBSQPH8Ht3ESgaspPvSDutGoJIKT1FvIRPMkkCi4kW26l+XWDewdZUqyXPLyV4H47RrebZRh8zpWltNcpfY+1fdG25FxBiskr3j5VN+dHt9K7H8eTJWkKoxOSSXmVkpJspKhZSD1SodCI4XisFXwdZ0q0bNfe67UfT2CzDDY/DRxGHlqi/vZ9jXUVUvgiwMYDgekpmyl6/UfGKdJUpmYOEE77xRpJ1mZL1kiI0k6jbRMAgAmKHAnWbCXQRFOkq1mUOC97xGkawU5zhpGos7TfnDSNZXXcc7Q0jWYnXfsZipRI1DCxC/d9tF+l49XDx2Z59efIaRdN/WEZukwdYv4jlrBualyFNrAWhQi1Qf6rFftQrSz7VWw0w+nd9I0PpG+46xYcHSqNdC9GoqlNMU8OUMU6acnnGz2yjZpB5geMW69VzioorowUG2SFISoQ4XnDd5RuBHmS7EZmo3nXAls77geMW1EnUIc0+NRN4vqBS5iG8+De5sRyi+oFGuwnPzNjb3xcUClzEt2buqwO1ovKBbdQTnp1CGlLcWEIG5JPIRejSlJqMVdssTrQhFyk7Jc2RzWMQv1GZMpKAplb2JAuVfijsuS5HDAQ8fWV6r/l9C9Paz554k4lnmknh8O7UV/O+1+jsXrYo0LDr824lxxFkeG/x5cvON0XI52O6oz0pS5BRPfcLd7rVvbfcm+1tOxilkK5B+KMVLcdcbS5chRIJ8TcKVb3jbrbyiCpIiGeqS1qJWogbnc/l13idisaVQqWgOJCgTfYRAGZOVJbr5AVz2H5e6AE9iXnKjWG6dTZZ2oVGYOllhlN1KJP0Wve52Ai1Uq06MHObskX6NGriKipUouUnySOp8v8jKbIJarWNp2SnKiLFmQVdbDB8SP8Yfb3fAHnHMcz4gq1W6WFTUe3q/l8TtGS8J0MOlXxzUpfs84rv7X7u8nv0Kk3sa0DbYaZZVhGkaqv7J0vTS/a9wfN9NWbNVtkHp2rSkw1zXOLGim+UgVQZ8oK5VTM+j/wDDuhR+HOHjad7PbvIdKdrrcSXEusPlt5tTTg5pWkgxfVmrosNuLsy5LohpJUzIHU6gIjSV6zKFjpEOLLkZXYpCVlhIsvPTBbW4AQkIBsD77++PPdWprcYxvY3WOV4KOFp1a1Sznbonz9F7+sUKfhp6p42kqTKu3S+Ctx1Q2abHrKPsERHErxMpzVrHmZllawWIjCEtSkr9wpYvrcvNvNUikjsKBTR2Mun9dWPWWfEnmTF3BYZ716nnSPHrVk/IjyQhU2YYpValpmqSHpjAsVyrl0lxKhzB6bG4PLlHtzg1SdnZvr9/eWlNQ3kWVtEkziJ0Uqe9Pp6khbLhSUqQlQvoUPvk8j0ixFVKsbzVmUTneWzHPgykU2fk61UKmgOy8k22lDag4UqW4oi6g2Co2APKLVdzg4Qp85X7OS79i5Taa3Hs5hOkSeIqfLrw+Z41CpejlLU06WpVtKUal3sDfvE2VytaMJV6lSlKSnbTG/JXb3293TmX7RuRLMyqU1qbbliVS6X1hpR3JSFEJ+iNihSvBOS3sUaSQ6FJ4xcwmy1TZoJkLLSy2XUBdiSFBIPeAJ1cvOPMrrAxqvxi3687evoXNTWxtVenYu/Mk6ioVBt2SbQCpkPoKnEIHrCwuoJNha+0W6P0J1lojv3PZv4XFxqYcpsrOY6pspPNOPSjj1nUNq0kgAnn4bb+UZuKi6dCU480RZXJDYwpSJmuvUY0NTDAk2nRVO0WFFx1SbJTfukWVYDntHiSr1YU1V1X3fk7clf1k3XYMzE8lTW8EGcboPzHMfOypaX1Kc1PNJQSVKC/PTuPGM2jrdXRKepabvls2/QWpyWkY1KRIrxDLipza5KnXKn3W29SyAL6UjxVyB5C8X5RnTi3BXf35+gxoztLc2J6ZRWK5MzNMpwk2rFSJVkFQbQkcz47C5PjeL0I/k0nK77X1bLjnr3RsU+YbelDT5k2k5g2bVf9JcHL8ceZiaLg/GwXeXIVFJaJcn7mJTjTjMy6w8mzzatKx+H2HnBWauiy7p2fMx6Bex5xcswU7IqVZIuT0EUtpcyhuxRco6ACUHfraKVUhfmW9aNRaCm4tF5MgwKKk7DkIuWKHJmMu25iGgjWbTNQW2w4wpKXpdwWcaWNSVjwI6xT4uzUls11KvGJxcZK6fNPdDExDl/I1enlVECvRUkuLpYdKXW1c7yzhNjvt2bgULE6SkxvOW8Q1KNqOO3X7XX1/NHMc44SpVr18t8mXWHT/i/sfqIJqVOepTjq3uzbYDujSVrDjStwULStKVJKSNJJAB2IveOlQlCpBTpu6fVHHqlOpRqOnUVpLmnszJI1ByVcSpKikg9Cd/ZE8yglbDuIyppDS3ChP3VyDf8As/LeLbVgSvJTCJmTCSpBBFlXPiDZIA+J8iR1iCGaFRpKHW3bc76See/h8efv8IuDkR/P09bLiwoef0xFiOYgKU9KzAW3qTY7gG0SLWQ96FiNxudS8yodobJdaJsHQOhPS3Q/gMeFmmWUcyo6ZbSXJ9n9mbNkmd4jJsTrjvB+dHt9K7Gu31Ml6UqLczKJeZXqQfHmD1B8xHEMThauGrOlVVpI+mMLjaGMw8a9GWqMuX36PtQptTe/O0YTpmeqlzcRNAoveKdBVr3NhL+rcWihxJ1o2EPi3PmYp0FSmbaJjkL2ilwKtZmD1zzEU6BrKl+5hpJ1lC9c84nQNbLw6LeMRpGowOu7GJUClzI8rz96oQDcBMexRh5B51ae43O0MZGgw9RINJo1RfwsmRqOlGg/Y1DchPhGDVnCNTVEyKcZOnpmOSkUORoba9Lmgr3UtxVyfdGNVqyrMyKcIUuQtN1CVSshka1dVmLDpyfMu+MQoMzWo3Ktj4xbcCdZgmZ2wteCphzEGYmgRuRvyjIjAocxEmJoC6ibecX1TuW3MR3Zsk2vaL6p2LXjNhNemwltRKuXPwEXVTuy1KpZDAqlXdqc0ZSTWTLA99afuj5eUdXyPJ1hIrEV1+UfJfsr5v3HDOJeIXjZPCYaX5Nc2v1n8l736Bz4cw0VFDjzZ0DmVdPbG78kc1HnWKhL0akqaZWltxKTuDawNgT5DffmD0ii9ylJo59xViRT024hKgm56m9iDfl4AbAeZiCoiCenfshPMG9t+fX4xUytDMqVSAbUAq/MEfl4/XFG5Iyn5pbxVqvYkRIFTDWFqzjCuuU+kNFDbZHpU84k9jL+IJ6qtySNz5c483GY6hgqeqo+fJdX9+09jL8txWZVvF0Vsub6L+/oOusH4Ko2DqSWaelT886kelT7wHavkfQlP7Ube3nHMcZjMRj53qPyVyXRfM7jlmVYTK6dqSvJ85Pm/kvQh6JFje1owPFM2BMz9m8jTqQpGpIUm6bXB5EeUVKi+wqvI2XJabZkZeYdZWhh/V2Lik91zSbG3jY7RcVO90uhXeVjVSpSF6k3QQdlJ2tFmVBW3RRqaFVmtTSm0y84lupy/Lspkd7+KvmPjGFLCJO9N2ZeVeXKW6LzTpKoajSVqbmR60g+qzn8RR2V7DvGPqnT2qr1jTCfmP1Dcd1sPqQsFJSbKBBBSfAjoYy0k1cxHJxZkRMAjcxGkrjVsKCKu+yyhOlpwJTpTrZSo2jDlhYSbe6v6TZqWfYqlSjBqLUVZXj0JGYnJiiZMfOCghFarx7CUCEhPZS4V9Go3PsEecsPCpivFR5R3ff/AGJxeZV8TRjOpZO1lZW5jVpNDma/NTMvSlNPPSjV25ZToS7Nb94tg+sq+9vC1o2tunQipT2XbbZd54MHcRJ6dn5hbMnPlaPQ9TbbbqLKZF90G++x6HlFtQ1ybXUtSqOT3NTX0B90XdF9kiNYs0moVOQmVrps9MSK1iy1MOlGoeBtzjIWFpzjacU+/cyqd7Drkp6tolXmU1ObbZeJU8kTCgFk8yd979YuPC0G03Bbcti85pCe5UKVIkpW72zo5oaGr6eUJyhEsSroyM41flENvSTEw20ysBCu2slJ3IHh1Jt7Ywp+KmneN7lrx3UscxrMTjjipliYmCUkuH0gqOna979Nh8BCn4qO0Y8iPHNsvlq5TnHwtmYXJPgG2vu8xbZQ9sZSlTqKzLqr3N+anKm5JstfOEy5LtkKaR26ilFuRSL7W6RUsLRu2orf0F/WmNiqzVQnX0uT02/OKQLJU+6VkD3xH0enCNoJLuLc7tCGV76bj2XjGdNroYmoyyj86l5UpILcUuaKWlMs7l7fuosNzv0ixKnokpdgU2nsOKqUd+gPMSdQmZdE3NIvMSrbmtySWD3A4RsFeQOwveK04YiDlFbdvR93zLsnpNacc9KpcvUCnTMNK7CbH0JPx294jxoQ8VUdN8uaL0qmuCqLuYndoBzjOjKKuW9Q4cNVCSp2LZSenkKcYYUV6UAEqUBtz848TG0qtajKFPmy1NtrYltOMsIehhLfbtkMO6P0Ig6FKNyBfnr3uekawsBi+q95aTurWIJf7MzGkbrWbIQlJKlHwAEbrCMrdxfTsrMV04QqKZVMzV3ZbDUorcOVJ3QtQ8mxdR+EW3iKado+U+xfMr0Nq72XpNVbeBZI2dqNQrbg/wDszAZbPsKt4rvip+bFR7yL4ePN3MBrGEGxZrDLzngXp83+gRV4rFPnNewp8dh1yiWis4ZKxbDzzKr7FueP4RDxWI/aT9RKrUP2TQrqcO4hpTkuG1y00pIDb800l7SR6uq3rpHgRHtZdmGOy2fk7w6x6f2Zr+b5Vl+cU/L8ma5S6rv7V6PYcz13Ck7SKm4wJQtTaiViX9KCmn2uXaSy1AFaQO8tKyFN6rWsNUdewWNw+YUtdJ79V1Xf97M4HmOW4vK6/iq658muTXavtXNDflZpcrMagbaVbi9wkg8jGc0eUSlhrE5bWlLjihoFkjUbJHU8/wAvdFEvQQyYqfPszcuhSSkqHqhQsCfE+XQbdFHwiE2DWqNJ1pNgVqJsk6e8q1unmT1/BFZG6I5qNPUgFBHdtcW8Pb126wA1ne0k3kuIvpSb28YlMWHhh7EvYzIN1K1Js63ewVbw8x0PuPS2vZtlcMwpbbVFyf2P0P3G25FndTKa9p3dKT8pdn+5ent7USqxPIdl0uNuBxtQuFDrHHp0J05uElZrmfQtLEQq01Om7p7prqbjc3y70WHT6mQqhvNzm2xNot6CvxhuNzYCud4odMrVTY3kTSb3vFDgVKobHpI270U6GVay/wBI6XtEaB4xFweBX1iHEnWzaQ53TvFOknWYH3O6RyiuMSHMjWsv3qr2/I2j2KUPIPLqz3ETtNovaUYuoezmKam8kALDST0QIwlhoIyPpEmWMzs0+7d11Sz5qiXSjHkSqjY55F1QCSYxZRL8Z9ouidCGee9ox/Fl7XsaMxPE2N7XG0XFTRS6giOzZUog9IvKFijWI8xOAKO+qL0YFl1EJExOpQklSvYIvxp3LEqqQzKlU3518yUrfQDZ1STz8vx/CN/yTKk2sTVW36q+35HLuJc9lFPBUHu/Oa6f7e/t7B34Yw2XnWlqbNvNJ3joS9JyMkOpTEvRaOptADZtz8uXt57W84o5kXuc64sxV2xfSly6uQGrwvb3QJ5kMz8+V6lKVzN72iWytIY1TqYCSlJv1teKSRmzEytaitSu6DfntDkB14KwJUMaVdSiVSWHmXNMzOpPec8W2vE8rnkB57R4+PzCGDhZbzfJfa/R8TZMpyitmVS78mmub+xen4HXdGo8hQ6ExS6RJolJNoHS2jqTzUT1UTzJjnc/G4mq6lR3b+/qO3YXD0cJRVGjHTFfe77WOaoyRpT7CH3EPB6XQ+ytpV0rSocwfI3SRzBBHSKF4uKv1Tt60Z7kocxTxDOUuZaok5Rg3LuO01AqEq2gjsZhBKFHfosAL28TFmDrWkn2uz9D393ImVW9tIjOzVQnWpVt1RUmXZ7Fs2sQnUVAHx3UYqVOZRrkx4VKi4vXlbRXZigTEvSae26tE7Y2cS8sKClDoOgPI3ixHxXjZRU1qdtr9iLj8ZpQ0lz86mhM09baQw3MKeB0XUVKSlJufABI+mMhRqQlqKPGTXMwBxtTQ73eJIsYxlUqRb1K6Pd8Vg69JSpytJvkWqUtDoUlR1DkQdwYvaIVV5J5FWlVoPyhdRMMV6XRLVFYYqQTplp4iwc/aOePt6R5UqU8O7rePZ8iVNVlaXMaU03MSFUdlZlpTLzZspB6fjHnGXHTOKa5GBJuEmmblLYcquIZGnM7rmH0t+y5imdqcHJ9CuDc5qI9sw6k2/mD82ym0nTGUyrCQdgQIw8totU9b5y3M7E1b1FFclsNyoeiySJBVNqRfWUhbiQ2pp2XcFuZ5HyIPTcCPdqXtoa/uvv0LEp6UkiW8uKdQqrU0V3EFUp9WrUxMuFyTqUz3kNoSSt5SSPsijba+wFybm0eVi3WpU/F04tJLml17PQv/C7TkuvMXk0WVkcMudpRaY9hv8zTky5Uy0hS35xwEoS25fVcKUkAAckxOpzqpKT160rdkVzujITRFMkwzJya5maWG2Wx3lH6vbG1ySirkTqqKshAqldmJuyGkqlZI30J5awNrk9fYNo8irUlLlyMCVVsUGKfQX8Jy8y9W2ZWdSwpbjI3UpVzZJBPMADlzB8RFtU4tLYqvFxRvYemXZzCzknK0SUmXGVDtX5iZQ3dStRSbKG9hcX8PCKoWaJhU2sWNKGGaI3850mUnXJhS0dq1OJU4jkdCki4tt12hp0Ia/F8xPo9E+eJaYqKpmWYl0PlKpVTulaha9k+W9h7IojCMpXZRFqTuxPlas/Sam7L9omblUOFCk37qrG10+EXIzlTlbmiFVcXYljBXzbPY6p864xLz0kG3XFImQNKSltR3B21AgWB23i5jdUsG3TbTduXpaM2FVMk00KmSokqXV5GRfkXnJdhS0Sku0w0rUFKX2pWXVFRBTuAO90Ea06s5uVSm3dXe7bb6La1lbn2l3Ur2IixxMzktgqkIq7FPkMSKqjz7aKellC5eXCQEAlrldVyLm+0elRhBzlobcLJb33fXmYtSfk2I5p/ob7s0KhNPICmypsNt61OuHkCSbDzJvGZDUnp7S1GfRmekO9q/NSDqtplopNzyV0PxtGDjKbjJVOwv0Z3bg+omdusLGvuqFwoftgbGLekx/GdptIfABN9vG8UONy7r2HJQaLOVqUfqTsw3SMOSptN1SbNmwfvEDmtf7UfRGLWlGn5POT5JcyuOqorrZLqZZ/HNPpOuVwVI+jK06V1mbbCpt39wOTQ8hvEU8HOor1nt2Ll6+0oeIhTVqS9b5keTM7OT04uYm5lyZmFm6nHVlaj7zHqQpRgrRVjClUlLds173O9veYuqDI1FNQtzAhoGorq25iJ0E6gCt/wiI0MajO8ZSoUN2lVRlUzJOG+y9K2jyKkK+5Va4v1GxuIrozq4asqtF2kvf6H2os4ijh8bQdDER1Rfu9K7GQ/izCj1Ldad1B5tav0NPsy7aUTQAsUPBJBQ/bRYBOlQCiN9o6hluaU8whpe01zX2r0HFM4yWvldTUvKpvk/sfY/iMiWmXpabKSHGXkKstpxBSpChtYg7gj6I9vkawSlhrERbdShTlxcAFI3PkB15D8PK0UNdgJvkZtudkgkoAcUNkJOyj0733tySfEg9BFN2UiTVqUgoUtCSsKsQQPWBJt9A+A3isgjWoU9TYspNwd0nxEOu5UmNCYbdk3gtsbX3F4q2DHvhrEY0Bh5zunnc8j4/j+MajnOWfSo+PpLy1z9K+a+Bv3DudPBzWFrv8AJvk/2X8n7mSIiauAdUc1cDsqqG2iZ87++LbgXFUZtIm9r3ijxaLiqG4ic73PnFt0ytTNpE5qBBO8UOnYr1m0mZuQCbeyI0E6zcbcNud4ttFSmKCHbItfpFvSVazTmXyNQB6XMXIxIcyMak/qnnj11R7MI2geVUnuJoXsIr0lnWONlO48IsMrTYsSyNJFjFp7l5Ow4JdwISBffpGNKNy8p2Mq5m6Dva8UaCp1DQdmu6AVXMXVAodQRpidQlC1LcDafpMXlAtSqpDYm6wnvJZ38zGVGl2mHKv2DdmJt95wNNKJeXyIPqjxjZMsy/6XWvLzFz9Po+/Q1HOs2+gULQf5SXL0en1fEeOF8MrmnEDs7pHPu3vHUIxSW21jispSlJybu2TM+ZTD9BOsBKwLk8iOg387geB5xbZZOc8Z4qU6859kusquoAiyTtt7dh8TEouL0EE1KoLdecWtVweZvz84grtYYdTqNrgnnyuYEjJmn1LWpSvVHO8APTAuApnF9RM3O65bDbax2i7WVNKFiUI8uildNwN+XjY7HLDLRDeb93pZtGUZRPHz8ZPamuvb6F8zrKnSMtI02XkZGXRKybKAhpptNkoSOgEaR4qpObqVHds7LQpQo01CCtFckPip/mfmsASNQo0wmn1Vgpl6jTnVlS3jY2mGieaTyUn7k+RixevrcLXT5NfB+nsfVGVKa0+TzGr6PMJdQ0824lZAKUuJI2PUX6GHinHeRY36nT2CMK0xzJ6mrnsONlbstMzT1ampRl+XSAToSVFWpNgm2nY3PKPCxVeccQ1GeystKbT9PSx6EbaN0Q/L0KozWpyVp0y+xexLUupSd+lwI9p2i/KdmY932EwY1r1Gn8JVNliTfFRmWJdEs27S/R3JRtAAVqdvdxJAAAItHkYTC14Ti3yV773u32LoZE6iadiGaNJPPYyp0uKQqtqceSkU9KlJMwTySCncX53HhHr1YyjByvp9L6FhSbduY4MypPCcnUJKlUOmsylUl0n51dlZpbzIdP8AikFR308irqb25Rh4Xx9SDnVd4vzbqzt27dvQmo4XSRFKi4x691t9FDpF2dCUfKgZtHHOMfF1vKj70bKH221FpzvtrGpxoHceCh4Ef8ecX6bWJg01uveRjcOsLUUb81e3VJ8rio+hOIKCuXUoO1iTReWdH/tLY+5PmOkePKLw1T/azEk/Hw/3L3mbK5tLuZnpTo7sjKuvm/QgWH1xbx11h7Lq0i3gnerd9EaNMnqTM48enq+1NTFOcdcceEo4Eui99JBO2xtt1j2sPSnCjanZNdvIiNRSqOTMdeaoTNaaXh+rP1WSdb7RRmZTsHWVXP2NQuQTaxuNoiGubvONn33LcppyuhJQ4oKFifcYzaUW5Exk2x40eXW6EC5Ukb26R6uhc2ZzmoxEuvT7s3MuMSqFqkJVQQpaEkpKz1JHsIHsMePiJOctMehgym5PYrTcSS9Pw8ZCaozU+4FKU288rdGobAAg7ezn9MYyelWYjV0qzGr2lgBfkOcWNJZ1B2l+t/fBK3InXYp2ov4RDTKdZQrCjvaFmNbHnTqlhSToMq45KTiq2htXaLG7ZUbjYE25Hw2O8ZEFBbl6NSCEeh1g0+oIbdV+hXSEugn1egV7vqi7Qm4Ss+TKIVLMdVWl9Oo2Fj5R7ui6PRjLVEZDitLh2tvHlYiLTMKcrMXMPfM7lcArjs21IIQpShIpSp1ah6qRq2F/HpHmVFJK8efp5CEk3ublcfp6cdNTVHkXKbT3QhTTTr/aKB9VRKrbknfbaKqkZVMKnN3fo2LznpmmhFqag1iOcTYaVrDg/jAGPOpK9Newpqu1VjowvQ5Kfo03ibEjy5LB8gvQ4pGzk+9zEuz5/fK6CLFecqclTpq837vSyunaSc5PyUIuKMXT2J51hvskU2iyg0U6mS+zMsjpt1V4qO5jJw2DjSu+cnzfUs1cQ6rsto9g1VKQgAk3PQXj0XBJbmPqS5lqVOurs0kn2dItt2I1OXI20SD6gCpYSfbeLV0XYwkzN82Ktcvj/RijUl0K/FPtMa6e8kGygv6IlNEOnJcjTV2rR0qBHti6vQWbuJVL4Ku93Tfn0i7aMuZOtM2dbbkg/KTku3OSD6dL7DydSFg9D7j7RDRUpyU4OzXUmWipTdOolKL2aZE+J8JqkFJmhMuzVLCC1Izbs0QppZ9SXfLh0gX3DoI1cj3rX6DlmZxxi8VU2qL3+lfI45nOSzy+Tq0d6T6/s+h/YxoMOuyM0UPNLYfSoBTKxYg2BAO/mI2BqxqhKuGsQ95KVrukgXBXZK+hufDoT7t4oaBNMvMtTsuErUlxQHeCud+VrdBe2w8hyEUJ2KbDcq9LDqiU95KSD3QDcbj8HsFouDkRtPyBbeWlbYUATzG35fiiOpN7jLfS5Iz4WjZN7je0VIkkLD9cE1JoaWv7IkWF+saBnGXKlPx9NeS+fofyfxOrcP5tKvT+i1X5UeT7V818B2tTW1wqxjUnE3xVDdRMb7m5ihwLiqG0iY5RToLimbKH97A7xS4lambzT9kj6YtuOxcUxUZfUdNjaLLgXFMUvSPsZ8fbFvQVahMmnzoWb8x4xdjDoUuexG067eYcN+a49dRWk8ic9zW7QeMTpRb1j8aRYi9hGE4mXqQpIUE8yAPbFpxLmoq5PtNJuVge+IVNsOohHma8w0CAq59sXlRbLEq6Q2pvEbihZogefWMhYdGLLE9ghPT7r6rrWT74yFTSMZ1HI1i+bXG56AcyYyqNCdeoqcObMTEYmnhqMqtR7IeGHaE9MzSVrb1LWoajbb2R0/D0IYaiqcOS977TimLxVTG15VqnN+5dEdB02nS9FoaXXRpISSSCCfO34ovvc898yD8fYuJddaQsHTtsbhPs8iTt4WgVJHNlUqSnX1BS9Vja5Nz8YkuJDAqU9oQTq90U9SRkTT63XVKB1eRiQOvCOCZvFNSl5maSuUw6UhS3fVXMb+q34DbdXhy5x4+Oxqw0dMfPfL0elmw5XlssdU1T2prm+30L7X0Oq5KWZlpFmVlmkMS7SQhttAsEgcgI1WFNzk5Pds7HSjCnBQgrJdBfXWUS+F5ijKkmZgrUHGpgjS6wra9lD1kkDdKtuosb3t1npn5L9Ho/9L0qtlpQ4su5/C0hjhU1iuWfm5dpgmUbaYDyO3v3S4gqGpI3Om+5AvtGFXjXdHTRdm+fTb0PoxSnFPckjM2o02vZjtTdNqSqu01IMMGZU0EalJR3rDwuSeliSOkYOBozhR0yjp3bt3svzmnLYYL1Sk6VL9nNTJClb9ijc+8ch749ZxhHdll1EhcZzixbJMvS8gexZl2UBTczpBShICEgJt4ECw6R588JhZt3hvz5vqR4+SLkZ046dqEuovyr63GSsJCU+ruo3vsDsSQfKKVgsKlZQ5+ljx82zHP5lVGrv052qF6jzDY1yr7LIZACk2uFIANiPrjNpYbD001bZ9u6K/GvrsNyale0HaoIcSrvBSTcKj0HR22DfYdIuYWw7SckHVzlClX2mcMGZfnXJBJQ/MLRdOmZ131AqHdCfuSI07x1aeKtGXOdrX5Jdsbe+5lySUOXQ4xfCmHgpJ2PImNgnHTO8TzZNp3FCQnHGptqYYVZ1B1o9o5iLeJpxrUta9ZepSk5eTzJPpEtLyS8SVuUsGJ2il4JG2hd7LHx398a1UcpaKb6SM6GmOua6ojKSfkpKiTbc9IKm3XpdvsXW5ktloqTq5WIUNxcHw5xt2mUaN0+z1nmKWmmalPkqhU5oy9NkZiozOnV2UswpxVhzNkgm0Woq0W3t7iiMm+QuyGGcSTkzMty9AqLypVWmZCJJwlk2vZW2xtvYxnUnRpJOckr8t0ZVNO+44BMGm4SnJj1XUt6UbfdHYfXGfV8im5FdWYyKPXJyjVj06S7NxwIKSl1JUg32uRfp+ExrsdSbMJTaZhq9amaxV/TJpDaHNCUBLYIAA5cyT1imd5u7KXU1O7EsugERa0lGoO0URcC4idI1MtU4pI3FoaUNRb21xz98NJGsWKLPUyVrfbVeSVUZQNKAYSrSCo8iT4DeLkFFPcqjNJ7m9WqxSpqRblqPTPm1orC37kEuEAhPjbmTaLs5RcbRK5VYtWSHZRhN17DEhLSjDk7Pk9glplBUtZHKwHlaPaozj9H1zdku0zKFS43XaHWX6dPVCXpky/IyjiW5l9DRKGlKOlKSfEna3OLGIUG1G6u+S7SKqbexsvYbxHQJiVerlDnaWxMKKGnJpgoSo2va/jbpzjxpaZwelp27GWYOUZG/VlNzGGaelqUZl3JRDhceSpRW9yVvc29gAEU0fKpTTLs5bXGzWguZxNT5ZCw0ZltCFuHkgaiCT7owqS005PsKcQ9VWKXVIW8T4hl6tMylLpoUzhmjtej0uW5BZ+7eX4qUbkn2CLuCwrjepU858/l6iKtZTtCPmxGQuZKVFKLeBV1vHoS2domL4y3I2paVK7OPXsTcJ8fbFiUWVwV92LLaQlACU6R4AbRZcGzKUkkbKQrYWh4mfYXFMzBKioWEUeKl1RVrMuki+0UOnJdCrWirVLeqLymmm0qKUFa1rUEJbSPulKOwG8Y1arDDR1Tfd1bfYl1MmlQnipaYL+wm1DC9Vkmpl9UuFyjLKXlPtOJW2W1K0BSVA2UNW20UUcwwlaUYqVpN2s007pXs102KK+W4qipSa2Svf0XsNtLym1lKt0eA6eyPbi7bPkeKqltjaYmUKYdZeaRMyjqC2/LujUh1B5pUDzEXIU3OWqGzXIqvGpFwkrp7NPqiOa1gpbFTL9OdZEvMKJYmJolIukKUphwgGztv0tVgFpGn1rX6DgccsWvF1Nqi5+ldq+05HnGUSy+fjKW9J+59j+wZUhULOJdaeJF7907g+Y8fbuI9R+k1gmnClePYNNFdwnxVcp6XA8fyEW2iLkutlqalVKJGoADfe1uQ8z1MRewYw6zTlAKKU6TYi35fl8YrIRG1TkAtLiSIL0lQ0WXnqVVAtJ7oV484icYVIOEldMu06k6NRVIOzTuiUJKoImpFD7ar6huB0McxxmElhazg910fajs+X4+ONw6qLZ9V2MVW5roTHmuB6yqdpvNzAP3UUuJeVQ3W37EWN7xbcC6piiw/vuYtOBdjMUm3xa9xuIt6C8pm16T3Tvt7Yp0InWJ03MEoWb7WMXoRLcp7EfzT1zz5qj0tOx5MpmPtR+RirSRqHI9iBtHqEExiqi+pcddJiTMYkdVcJP0xcVBIsSxLEd2rTDt7rPxi8qaRZdaTNIzC1k3N/fFxRLetlO1/K8NJGor2nKI0k6hy0OmLm5hLqx3b90EfExu+V4TxNPxkl5Uvcv7nN87x7r1fEQfkx5+l/2Oj8KYfTJyiZx/uBPK9tvO/SPfdjURs47xQGJGYl23ezsmxRexG29z5ja3nFKFrnJFeq7k5Nq1KB35X5bkn6zElaRHFSnQltW/SwgVDEnZhbrhIvbygB9ZPZezOZ+ekhRG9LdFlQZ2uvuJuhMu13lN+ZcA028CTHjZlmFPLsO6j3lyS7X8j3Mqy6pmWJVNbRW8n2L5s6Qrk41NY2qD0u2hmXLpDbbSAhCEjYBKRsAAAAByAjRoyq1X4yo7yfM6rGFKglSpK0VskKuHa3O4eraK1IKbRMMBQHaspcQoKBBSUqBBBBI98Z8aUZUWprZ+lrl6UZdObj5Q5pSeoeLcyqdOTGElU2RS3esM0aYWltRvbt+8FdggXTq5gC9ugjHhCooN6rvo38NrXfYVKaqSu0PzGuC8PYcTh2aoSVIFRkTMOtie9LaH2QpSW3ShJUCAeY2jHw9SpXcozXmu3Kz5X3V2XpaY2sR3V6sqlypl5VOueKNSja/Yp8fb9UenNeLjtzLMqluQxnplJcmEJWJkOFKi84iy78z123JB8YwJbt9THczXXMKcWVOLK1crqJJ8Itu7e5DkWF3pCzGpDsp2MZxmTRIVZpFbpNtJl5gXUgftFc0kRkwqNbMuqq1zNlyq02kVhk0mcXPUeZR2i5ZwELliTYp9o+mMqNWNNq28X07CtVFF7chbnll6npWy6XJZaQpBSe6QetozpUotao9TJumtjdpOCmKxlzO12drTVKbbddbZQ6hJCy22Fm5KgdyQkaQrcxqGKxbw+IVFRvf7Te8Dk1HGYTXJ2+C6X+13a2IulJhbE8m3MKuAfEdPwR7NNK7g+TNBjVlh8RePR/f2ko0N1SsJ4klQbtppi1NfuSdX4Y12tT0VY37TMU1KEmuQhU3FOHqdhhmXqmCKdiUq7M+kvzTzLyfsaRpuhQFgQbbdTGw1YTdKLjJr0WTXvPMdS1PcdOWNWwnT6DiZyt1tVJmZxxppiSMzMstOsglZKlsArOlWkAXF9yYxasKktOiN7XfJPfuexVTmktyXmswsMz+IsOVl/FqZd2jT8xMTNOkZWZCairuhnQpXNOhCE3c353i1HAVvFzpxp3U0km2tu2/p3fL0GZGae6IGxY8V4SLxFvSJzUoeZClfWY2bGR0UNK9CMWpMbctjWqymH5inIRKrS6lSVOrZAc3Ro5i17J2AIPIeEeMqrtuiyqrtYaJcIFgeW3OMa1y3qBC9b6UnYE7xDiRqM5d5DkOm8RYlyLC5qG8TpI1GkXbOEROkt6jMh0BxJVum4uL2uIlRKlMfc5ivDz0otuUwZKS67bKcWFDlbewB8ORBuPbGZ4yCVtJe8bHsHtk1X2aHid+qzDrksxKrdVZkElRWwoJR7CrSD5QdCWKwU6MUrtr4rf1IuUZ2kSaxmpgan0imyRpVTp8rLVKRX6Eh9LjKUMr7Vx6wSNSlLAKgSSrbcAWjGrZbi3UlNyTbUt7We+yXPouzYzZT0rciPE2JKL+ZNqg0atTeIXJqvu1aenZiVUwEqUjQhtKVKJJF1EnYbiIUW5OTjbayV7+kwnVXRlapi5upYFmKYKNSqY2hACVyUmEvOK0lIKlkk78zCjSlFSk23t6i5Kd0MCuuFNVbCT9kDISD7Sbxg0Y3T7yK8rSXcL+CaPQ69iNVGrU7M0wzcutuRm2Gu0Qy8BqCnU8y2ACVEchv0j2akZUcPqgrv329HpKIWa3DL3C8nibOim0SdmwaWXnFTUywqw7BpKlrcSSNhpTcEjkeUYVZujRlNK7XJel7IpppOdnyF/F1PwvK4llJXCL5m5Usa3nk1D0pBUTsArs0WIHMWPOMmhRqVY3qK3qt9rMhtX2ESY9DpUkl+feIWodxlO6l+7w84zXRpUfKkQ5qKuxsv4ifdcPozaJVvpYalfGMKdVvZbIseOk+RoKqk6rczblz+2tGNzI8ZLtL2a9UGFj7P2yfvXADeKk2iFWmiTME41pkrVnEz8qyh10J7NTzKX20rSoKSrSogH2E+zeNeznLJ5ph1CnJxkr8m43TVmtSvY2TK8xpYeUo1FtL3D0xNihmsUip05qQbYMw0ElbMoGQ84Xg4tWkKIRsEgcybXPONZy3hrE5fXp1Zzb0vk5arJR0pXaWrm30tyR7eJzWhUw06Mb7rb27jWxhlDWsJYerFYqMwlFNlESvYuloj0p18XLaNzbRvcnnbaOgUa1CtaMHvvt2W6vv6Gj1Kem7Ikl0OOP6UEJSDuonaL6lKnJKKu30MjCYaeIbldRhHnJ8l2d7fYhRlqgqUMxLvNl6WeSEPM9oUarG4NxuCCAQehEZlSM4zUl5Mo7proYNTRKMqU1qi9mu1EY4yo0zKzTc8ZmbqiezU76QdLpcbKwRqtZQWjUdZsbix23tumBxscdT32mua+1eg5FmmWyy6ttvTlyf2P0r3iDSJ5cpOAa1JN7Du7jyj0mjwdmdA4YrDb0u0lS0gEcr7eYsNz4kjb2xba3A85yVbmJDtdiCOYTbnv8AA+G5MSiGiL63TS04saCDyNvHqP7YqCI2q0jqbLiR3gDaCtyKhOoVTXI1H0d5VmFmyr/cnoY8/H4RYqjZect18vWe1lmOeBxGpvyXs/n6iQg6QRt9Mc6cWnZnV1NPdGdMwQdjFLiXFM20Tih1t74o0lxVGjfbnzpvf6Yp0IuqqzdRU7WEUOncuqqbXzmm1rDnFPiyvxpqTNRHoi7G23SKo07Mtzq7DRfd7yD74ztJ57kWdp5n4w0kahI7VajzMXVEwtTZelLijsgwsibszJaWbXUE+d4o2KtzIGmh6zt/ZCzJ2LwqVSPVK/bEWkTqiKlNb9MnAhpoBAO5Aj1cBhPpFa8vNW7+R42Z4/6Jhno86Wy+1+r4k74Nw92r6FqbslO46RvnI5YyRMSVZii4bU22Q2dBAFrnYXvf373ijmy0ca4wxAqbqUwkLUUlauvrdL/XFdy7FbEQVGbslRvYnnvyiL3KyPZ+bU+8rSbjlbxgBMlZSbqtflqXT95t5XMjZtI5qV5CLFarCjTc5ckZFChUxFVU4c397nc2RtNksJ5dY9fkgQZaj9l2p9Zxx1feWT4nT7htHLs0qTxVWGrq/ZY7FldCnhMPKMOnvfaMhtwqeUo3JJj0IRCldjvNcdlcvVUZynyE0y+oqQ+9KgzDJNiShxNldOSiRvyjPqw0wTTafZfZ96MiU7QsW4YrNYoWJmZ+h1OYpU6hBSXpZ0oUUq5pPiD4HaLEqMalLTON16URCUk9iQ53EVUrEw9VK9UX6k8yzu7ML1EJTySPAeXnF/D0KdKPkqy5l9zb3ZEU1PrfedmVOvInXlq7bokoNrAW38rcrWjEm23fq/gYbn1E0umMfSU6i5PaLUdCSoQskTdsotS2/XQpPgbRFiHKxYHQbRNrDUXdp5wsTquPrDE8ZmmTVOcNy0O1ZuehNlD42Pvj3MFLVF030MulU3sKElKMz2IfRKhNql6aww9MLJd0hFk32uCASdIvYxYr4eEZ67bnqfTsSqPidb0LoNfE8pL0vGs3KyTynmWVgBalBR1AAqFxYEXuAbC43jCkkndHi1ZeWPjCb4eaLRP6okHpc36kbj6DHl4+PlqXpTPRoT1Ra7UxhfOq28vV0f5ukHFGauZpUoDNpP3qXL3A25W6mPY0OdBSTfd0PPk34uwkNufYhuQQd4tpWLKkLdMmCmeQCbR72G3ij0aM7jyxIov5dNqH+LmUk28CCPxRTjqd6Ny3UflWEJjEUunBc7LS2E5cjStK5zSXOxLgIHeUkkDfYXvcDfpHka46No8i3fbZDWXIziJBM09LrZlirSHHBa598eQq1KVTQpXZ6NXLMwo4RYurScabdk3tv69xPMy00saAXFDryEZGls8RzS5FfSEqAsq3lDSNaLFTKUpsFXPnBRZDmavaFS+ftirSW9RsBzpc28ohR3K9Q+ZifwAZZxEtSqm24QAHS9f7mxISVbG++9x+DPX0bsL2unbkb+ElhnClUeTfs3JkBBVzsE/2x6mAgtEmuVy7Qd5CBU5jVOL32EXcR5MWZNee1hHZc/RSDfYGNeaPOUtx8drW5fDfzNOSr8nJTE425ofkuzKlc7hakhXLpe0HFRozn1tbmZcZXGzVHu2xK6RchCQn38/wxYwdK5FaV6lvQh2S7poOUlRqqRon608ukyCvum2EBK5tweGoqbaB8CsRm17TqqPSO/r6fP2ESlpj9/WNCRnpmVfUuUmHJZxSFNqUysoJSoWUm46EbEdYU6euVi1GTuOhqZZo+G1VB9IcdV3WGz90r8Q5x7U9NCnqfP7TLlPxcBgTc9MTs85MzLhddWe8T9Q8B5Rrs3KpLVI89zbd2a4dIPOLTiRqLy7cneI0k6iztLdbxNiNRcHOsLMnUSJhavrdcbk31BU0yQuVWsatWk30nx/FGbC1SOiRl0qvRjqxJimt1yjVORn5lLrM/URUJohoJUt4JKQbjkkAmyRtGB4qNGasuSt6jJk9SEbL9mVqOLZ/CU601/y7KKlZV9xA1S80n7IwpKuYutIQbcwqMm+i1Ts593X5mJGbT0sZ9RaWjSpxBbcuUOpI3StJsQfeI9WvBSgpImo9rhSVonVLo0wkLamFgIUSbtqOwUN/ysI8RzqYeoqsHZosSpUsVTdCqrxl8fR6SMcW4eeoWKl/quaQ64VqWol0JVpGq6hdQ7wUe9fbrHRsLiaeMoqrD1r7+45FjcFVwGIdKfLo+1ffmbWG6wqVnkDXZKjvteLzTPOudF0OqtTcogK0XPIpIFvHexPtP1xbJMVbpyX5JbiUki2x029w894rTKERFUpIturSR3b7e+JexUmRpWZRTL5dQD7Rt7oJ3JHDQKoZymdi4bvsgA+aeh/BGqZphdE/HR5Pn3/3N9yXGupT+jze8eXd/YX+0I53jXLG2aivbm+xiNI1mQTB8TDQTrMiZpYPMxGknxheJxW+8RpJ8YzG7OKVLkXPKJUEQ6l0ajzt+x36RetsW5SLO184izI1mt6YkDuhI9kXNJjqdjGZ249Y+yGkObMZmrnn8TE6SnWynpJPshpGplyFrcdS233lKNgB1MFHcaiacJUI2YZCda1G6lW5nrG94TDrD0lB8+veczx+K+l4hzT8lbLu/udKyEq1RcNFewGi5udrjz384y22eU1c5rzHxKuZnXG9Q07ixWeQHIDw5e3eJSFjm2pzhU4tRO/WDZdI6q07qWU33PSKVzA0Zh7SgnftFGyUgXJJ6DxieSBM+DaEKFSe3m03q82kKmlH/FAeq2PZ18T7I0zG4j6RUsvNXL5nQsuwiwtO8l5T5+j0fM6AwK+Bk7mK2D31Msn3BSo1zER/LU+9m1YeX5GYxGHBrO+9+cexT5oxIyJUqeLsLTGB2aY/lzTmKmZMNMVWVqMy2tCwAO1LZUUKPUiwG8X60KsZpuo2uxpe52uZU6i0pNHRmX81S8L5C0aaTUadiBBkH5yepbLlPZQpbgVZqYLhLzikixskDwEeRioSq13FJx3ST8rp1SXk7+kyIzUY9vsObaw+lOBZ1aLDWUpsNtif7I2OcdNFsx3LyGyOZx4qmglM2qdbbQlDbhSU90DYWO4A5WjyJ2vs7mO5GqglTqE3tc2MW2ilPcWwtKW9KQABtFpmRexjWpK2yg7g+MEilu4glel0i/I2i5a5YvZmQODTzibFSkOTCj5TjeTTfuuam1eYKT+IRnYPbER9JXGW9x0uyiJ7GEhJOuFlp6YCHFi10J5qIvtcAHnHsYqC0mXUlcRMVU2VpUzItys76eh9jtw4LAaFqPZ8uRKAkkHkSRHhzjFR2MWbFzCzq2sPyk6LkMzh126JsAr6DHmYuOpRj2ozcPKyv2CnI4vxdgSp4np2FXmZYuzaJlLvzc1MPAkbaFLSojrsOojIoUoYnC3lu0u1r3J2FVyhqsM/CFMfxvnHR6LNTK0P1eqhMzMBA1JC1FTiwOVwAo28YuuShTlN/qq5hU/LlYfmKaBhaWy6w9iLC0lWJFU9WJyRRLVGZTMLmG5cIs8nShJTcrsRYjzj0cNVnSqyhWaSik7ra177b9x7GGo1K01ClFuT6Ldm1LUh+Zws9JVRXzemYbASHP0y+xBCefSIrZjSxMHSwkXVfo81d7ZukOGqsIqvmNRUIeneT7kvv6BkrxRTqFSXqZh+VdeWtw+kPzyRYkWAsj3cj4CNW8Ri6sNNeelX3ivmVyzrJMonbK8P4ya5VKl3v2qO32DLqFWn6pM9pPzS5g32B2Sn2DlGVSw1GgrQjY0jMc4zHNZ6sXVcrclyS7lyE0qTvaMpK54F0UUBYEj3gxAbsWhIJJvt7YkpvdhqCTYQSFxVo71JRXmV1pDztOCVdohg2Wo27ovcW36xepqmp+XyKoyV9xYrb2FHpArw81MyrqHE3bmlqUpxJBBtuRsbHp7+mRUVBw8jZl2ThbySZcH5c4jruW7aaO0woNPtsvl6YCD2zt1HbnZKQSo8gE9TtHqPEUMBTjTqN3ab5ff0JGbR8lXYhz+VtUTOTDpxJQPmxiU9JnKiudWhmVQVhtPaBSAsFSjZICTffwjFrYiFSNtMk27JW3fduRVvIj/FGHp7CGMl0eoPy0w8mXamG35R7tGnWnUBaFpNgbFJB3AMeZtKOqP3tsYj8l2HZOYkxnV6bISmK6vU52Vk2jOSjVRWo6ErSEoWnVvYg7HlYbRjVadKjRWhJOT3t6DLpNyabI/Q6FzTsyoixUpw38ALx6uDp2i/QWrtzbY6sdlySqWHcPKPdpFBlkLT/wB9MJ9KePt1PAfxRGJFak5drfyXwLc5cht0xovVBtFrgm5j2cHSu7su0ldjkmFST1bnpmqsrm6NRmEByWbdLaph11QSlAUPVO5Vex9TkbxRi2pVWnyj8SmrO8tyOVrR2itAITc6QTc2848VpN7GK5FCSB6sRYXLe1FzcwsRqLgsdOcRYlMuK7cwYqsTqHJR2Jd+i1Cdl5p1NakU+lNs6AGyygjWb8yrvcthYEknlGRSimm1zRcjJdB9TKkPS7UwjdDzYWn3i8V4iF0pI9CMrjZXMO0zE8lUZZRbeYeS80ocwpCgofSIx6a1JxZZqO0h/wCZ1KblceYhel06Zd59uoMhPIIfQl361GPVw0vG4ZJ87fDYlu8SJae8ZfE0s6k+o6lXwUI8fEQvFosQk1ND8x9LSFRxs/Sn0IRMuS3ayzutSFBRBBKVJULGxNhuD1EWcsxU8KlU5rqvQWc1wlLHRdJ7S5p+n+5zetmapVWcl30uJU0QkLIBSvbmFJ7p93wHKOlxnGpFTi7pnH6lOdObhNWaJZwjXClbbZWb3FvE/Df6ohooJ0lyicpOojUQLcrfSPqFyesUXsUsjjENL7MOmxBvvtb/AIeEXCERXVJArl3G9O4HL6YjqVkdMTDtIxEh4XKEqspN7aknnETpwq03TnyZeo1p4erGrDnH729ZJKZtLjKHEKC21AFJ8RHP6lGVKo4S5o6pSrwrU1UhyZUutnmN4tWZe1GMuDmDt7YWZTcr2w8bQsNQFzzhYnUWqcu2oDwibEORjW5csjyiqxDkU7TeIsiLiL2hJ8Yv6UYtyvaAcufWIsTqLtZv1MLC5UOLJFk2hbYke2EKYqaqiptwDQ33Wxbmo8z7h9cerl9DxlbW+Ufj0PEzTEOhhtCflS29XX5HWeBKGlKEzLqdhuNQ2G3P+2NsexoL2LMwsQsSVLclml20t95N9jc9bWuLCKCE3c4xxJVTN1F9wqB7x3A8/wAvhFfIrSIrqs7pSsX3OxtFF2VjAmny46pRVcdYkDxwRhp6bnU4hnWyuSl1lMmCnZS9u8fZ08/ZHh5hiNK8VF7vn3Gy5VhNcvHzWy5d/aSuVDSehMazY3G4+MuZntU4tpKuc3S1KSPEoN/wxiYmNtMuxmZhpX1x7UNFtwpfUDzj0YGNq3HjiGcw87hqkppdKnZSfSkekTExUEuoXZO+lsNJ03O4JJ2235xm11Oybaa6bW+13L05bJm9RqNW57CFTrcjTJiYpNPKDPTiG/sTBWbJClcrknlzg5RTim93yRUntc25sqmcvaggbqQErt5A7xnThqw7sVNvQMGdcWqbDrnYJU62lemX0hCQRsLJ2B23HOPEmm3dlhyMDQWo6wdCEndR6RZaSJXaKLc2h2+hYO/vi21YuKaZiemm22ipSgVW2F4JNlLmkInaFSib3JMXLIx73M4XyvEWKrjvwSwZvMenNhWkBZUpR5JFrX/80Z+Di/Hp9l2VxZI+JqBINV2jykvUhNOT9RU0ClSSG2dSQhRt90QokjkOXjHqVZupF3Vtl/cyJTuMbGFPkaYqnCT9KZU+hbjktOKQpxoBwpSSUgesBqsRcXjy6kUo7FiUhy0BJl8iKpPHYdm8oX/io/DHiYn8/Tj6F7zPou2HbNFNcnhTqZiOkTj0pNPSyqfNvSzuhYv6p1Dlfl74u4eUKNVwqebzMqkninCMectvX0NpODKhl4zRMT4sqj2H6i8528hJSL6fnBCk7pWoA3avzBPjGNWrYmU5U6EE1y1Pk+7tNhyzBZHRputmOIakv/rinfnyb5X7UvaW1/NuvVtxvs3nwW0FtuZmXC9MhJNyAs7JudzpAjHo5dBy1YmWr0cl7D2anFVDCQdLKqCpR7Wryf39Y15LErrEyXpkvPuKO61G5J9pMbzQxeGowUFGy9CNHxGYVsXNyrycmI1Zm5efrLk3KtuN9r3nErAA1dSPbzjy8XKlUq66fXmeTOSfIRSpQHLaMEx3IoAT0t74EXC67W5gecVWF2HeHshYgxlRtvtCzKbhqNoWFzdp0yzK1liYmW1PNNK1hCbbkcr36Rk0HThVUpq6RXCUVK8uRO2Cs8EYPlZppuiuTpmZvtX3RNllzR6O4yEoUAdKgXSsK6EcoyMbKhjWm21Zdia5p9vLa1jMeIhbZGeq54UuuYZmsO1vCs5VMOrlmWm0u19wzupt1TupcwUErBKradIAAFowlCMJ64Oz3/V23VtlfYtusn02GM+5UM2M0KzUmJqkUKdUygylPnZ7sEKbbQG22Glr2UpKEj1iL7+NoWSio9n2u5actbuJdVmfQsLyssp5bzr6UtpKllVm03SLX6ElZHkRGNU8utZcomZq8XTXaxQw1TcMzzsyzinED+HJPsndD7FOM2VLukadIUOhO/lHr4ZzWHk4R1O/bbp3Mlb3ZOOAcKM4/wCO/GtIqDMslSGJvslzdPD7TCm0tttrLKlWNgORO1/KPNxNVYTBqot7aeTs3ffnYqhTlKV+gp5s4EpWHc1KVLYfpUuyFNvpfVT5cobc0uDSooBISQFFJINjp5bR6GV5hRdFyxFRLlza223PYw+XZhiYvxFGUu5HOtblZiQwxW5WpK+bZyZqiJqXYdaWVzTaUrRYEDSkJ1lXeO/SLTxOGxPjHSmpb9DGzHKswy2MZYqDjr5ct7c+QwmwBqUVAnoLxhtGvpl2sW5wsVXNV1YDm3hE2Lbe5st2DCFc9QvFJcTsi/UCkjpE2Kr7C9hB9hnG49MdSxJuycy06txVk2UwsAe82t5xk0ElMoi7SJEw7T5+rYGpaZKUenXkShU4llpThQkEi5AGw5Rly0OlFNnpxjOMFKSsmOvODL5nBNYpqJF+ZnpN5htbzjzIAYcUkEtlQ2J5mxsbdOsebhZqrDVa3P8A9KZNvYVMxy0rD0i6s/ZnMKSKlbcyG7D6hGZgVLfsu/iHyaOdJQFyvNIAuSoAe8iLGIVotstRTchZzYmVsZss9mtTbrEuiykmxSR4eceZg43oblGNk1WVhErMs3izCUvUpNtSZ+WJ7dqXWNS1WO2hbgSQSb3AChuN+R2XLMS6NT6PN7PkarnGEWIpfSqa8qPneldv36DCo06tiabJJSbi4sR9B/DG2NGhvc6LwtWkusoT2hvy5cvIWi0yR2ViWQ/KFxA13G9hex8OQEFysRzIcrUh2MwoncnmenuiskiXEEgNa3UjcDl5xKJMeHp4rkXZNZ7zW6L9UnmPcfrjw8yw+qCrLmtn9nyNnyjFaZPDy67r7V9o4S7Yc41mxt9yge9piLEaipdBTa94WGotQ+O00E8+RidI1IuLosreIsydRh7YEt+Sd4qsRqL+0HnDSLmq3Lbm4v7oruFBszplVX5fREOSLqpNszeilJ3G8U6i86DRlYk3Hn0obRqWohKRbrEar7FUKDbuT3gqhXEswhGoJsLjqfH643fC0VRoqPXmzlmYYn6TiZTXmrZdy+fM6WX2dCweSkaCGzbSLXNth/x8Iydmzyr3ZyXmJXjMTz6QuyVrOmx202t79+RipKxVyOdqlOX1qJ+mF2i4RlUpouzCgFXERawEyQpz9ZxBLUthWgPKJcctfs0DdSv7IsVqsaNNzZk4ejLEVVTXX3ek6bVPIGGKfRZZsylMk2ghpltOxIG6jfmTGkSvOo5y3bOlQ0QpxpxVkhIdSlTqdGrSOeqJsQ2jNQaqaDj+SnrnsQrS6PFCtjEThrptE06ni6qZu1NlEriSZQ2oFntCpChyKTuImi7xRVU2m7El0FzLFGWqZrFKcQ1isMuq/wCTaYpqWZCfuVKfVqO99wEjlzMenU8bUpLQlZdXdv2Ky9rL94OG5sYcxnK0zh1xbhRlU0Jur1WUeSkm7KGGQsm+/rklHTcJ90WNCnVhU/ZTXrdrERn5FjSpPaou1Ny7qJd9JF3EFIWkixtcbx7VHlZlyL6CWjCKZWVmpmtqbp9OllrWmY7T7LNpsLJQkm1ut+ZJt0jUcVW8XVeHox1TW/cvSbxlvDkJYX/EM0n4nDrk/wBaXoivt6+8j+ZmlPEob7jINkJt08TF2MdtzQak4uTUeXTuNum0eoVND3oEuZjsiNdlAWvy5xYrYijQa8Y7X5eo9vK8jzPOFN4Knr0WvuuvLn90bD+Hq0xMvtOU1/UyNThSi6Ui1735RbjisNKKaktzLxHDed4etOlPDyvBXdldJWve625CNqtGbY1MqFXNomwuSbhOVMjhuaqbwAcmh2bAPPQDufedvdGy5dQcYOq+vIv01djul8MSlWwmiffE8h91p5xqYly2poFDgQlrszZSlq76tlCwEW8RJTnbYrnK7IsxTJopWMpultzXpqZYpT2oTYqJSFEWBO4vbn0jyJpXsjGk3exK+MWU4W4ZKZT3Tpm5ppCVJ63I7Rf0qSI8FPx2NbXJfZsetUapYWz5kPYNqjCkzNCn12k5xOkKP3Cuh9xjLrwe0480YOFqpPRLkxFrCJyTxLMszy1uTKVaVLWoqKvA3PMEbiMmLU4Jos1pTVR6mYG3yqydRsRvaK1FXKNbsbQ0kcj8YvKEewm5cEpI3H/mipU4voCgQjV6u3tMT4tdhBd2aDto+kxX4uPYNiZ8N5J1rEeWdBxOxUZKTk6lPOMqbfS4Vysu2HCZtdgboJZcSEp7xKfOLMp0Kc5QlF3Sv38tu/dGRGldXNtrJmnP0tiot5g0j5pqLiGaJNGnTf6OeUyXS2pOjUxpAsVKuLkW6xW9Klp8U7rmttle3bv6irxSIPU02lZBbFxtaMvxME90WrRLezZ59km8UOlC/mlPkgG2Rv2Y9lonxcEvNF12FSlnT+lJg4wt5qF49hrOEJuRsOgjz6kUpbItt7ith6RFQr4W6vspOXBcfcI9RI5n29B5kRj1J+LjfqXqMdcvQjMauzV84qQXkhNPE+yjs/uUthQGn2WAHui0oOFF9tiqVVVMQuy45q40qn4oq0qEA9hNvhKVC4O9wLeGwj08tfjKM435o9unVp05KMo3tK/eux+gfmPMaVug5w1U0Ka9CYnJaWnG320/ZHG5iXbd3XzVuoj3eUeDHLKMopzbfrfTY3V8Z4ynRjRp04JL/avTbbuGvScZYgna0DN1Z90L53Xa590bRgMtwHPxab9O551XivOq8XHxtu5JfYak7JTVZViaktapyrImWZ6TDi+8toBYdAJ5BKVBZubWSYqrYaFKdSlTSW9+w0zF4zFYyeqvNyfpdyMQspN0mPKcTyrsv9INvV3inSVajFqKlE3J9sLE8zMh5SAARqAiLFSbRcqZJTYCx8zEqIcxwUSQSqi1urT7KzJS8gsSxWCEuzC1BttKT90QSVEDlp3jLp09nJrYRuS9ScUYhwtR6exT5mXWplhAUl1mxvzI1Df4xhYrKsJtNXjLq0+b7mdRwfFFZYWOGxNONSMUluuiXoNzEuZU/i6lNSeKaet9hDutCpJ8Ius7AkaRqPhePLp4XHQf5Gr7Ueph8dwrUko1sJpb6xbfxaNzNSYErUZinKc1TMlIytPcQhNkICGU2AJ3Ku8dW1rgxsWXRxEacpVUrWumurfaa1j6eRyoxqYKUtTbupJbK/aRThGS+cMw6bLjvBc0jV5JBufqjysXUelnkeLpQouV93JL2bsamYtSFTziq7ratTaHezTby2ivDQ00UjV8VNTrtiVh6prpVZ1r+ySjo0TDZFwpPj7QdxaLs43V1zRapz0vfdPmX4upypGtIqAccMtMrQiW1q7RBSEkiyyoqBsAdKk7X2PSNxwVf6Th03zjszQswwn0TEOK817ru7PUOHClTCJlsFRIOwHgfYRGazyHc6IpzrM9R9AaSogA3CgoJ9vn5/RFpcydhj4lp9w4Qnf6z7fCLpC5kNVWVC2XWyNzsARziEmncqItdUunV1D6RsFbjy5H6IuWjOLhLk9mVRnKnNTjzW6HgkKcbStCipChdJ8QY0WrTdGo6cua2OlUpqtTVSPJlOzcuNyPwRaui5pkGhwbXJgTZgEOawYXGlmyltalbjnEXSLihJm0iXRotyX49ImNnzKnTaWxg7B68XNEixZjoapidN1LSAPEx5bqPsN1hg6VruSN1qQbU4EJUkqOyQNyYpbl2GXCGFjs5IWfzKVYyqnk0qcKAPWEou3xtFvU72uXXLB23e5bTKaUz6VKR3wdIFrEHr9H1x7uXYeVXEqUltHf5Gl5/j6OHwDhRflT29XU6YwFRglgTC0CwSLBQ9/1CN3fI4w+RTMbEDbEmqXS4AkWAueQ6kfA+4xbSIW5xTiWp+kz7i793YDpYXP4xF3oXERRV5vShSfjvFsrGC+966yLpSLn3Q6A6ayey4Y+YpOvVl9qWFUIcKHF2UlgeqPLVz9lo1DMsXqqeLjvp+J0DKMFooeNnzl8P78ybcR4ewTL4fdbpK2nZ/YJUharDxO/T6do8OFWq5eUtjYZU4W2IZqFOMlKKcDqVrvZKQbkmM5STZhSjpQ35+WUqVDgT3kxdjzMeaujLLzZnKSkOG7zA0m/Mo/sMRbTK5VGWqPcODDa6auvpla1POU6nLSrtn2pftljY2CU3G55XJAF7k2j0aE7XXO/q95ci2tmLdAfoNPz4pSXpedmcLoqzC3WXUJcmHJdLiVKBSmwKikHYbG9otzboak3bZ79L22MrDUalauqVOLlJvZLds6dzGzCpbeH5mk1SsO41n3cQvVaRCm1tNyjK0aWpfQsakJSDcp2BNrDa8atTnUxM0sJ5EdKUpdvbbtfpOs4TK8Lw/FYnNkpVf1Kad39Z9Ld/L0nOVfnRiqXQqbdCam3fsdOyAPvbdB5xuVDAYZYfRSVmuvV95o2cZric4r+MrS5ckuSXYl9vNkbvsvykytp9stuJ5pVHmzpunLTJWZqTdjbplWmaVVBNSxBISQtCidKwRaxtGHXoQrw0y/8PeyfOMVk2LWIob9GnezTVt7NeocExjequ0pEmwluUlwTrQkqWFXBFjqJ23O3jHnQyyjGWqW7+/YblieOs1q0FRoRjTW97XldNNW8pvtGbqNtt7R7Njltxeo9MTNzSXpxRakkm5++c/ap/HHq4XBus9U9o/EvQg5bseU/VQtlLTQCEJSEoQnkgdBHuV6sIRtEvuSirIbLz4Q2XFchv53jWZTc5XZYcrIWcuqA5ifNWTQ62XZGWWJibNuYB2T7VKsIw69XxVNz69O8qoRdSqrm/nfiRFWzM+apRwOSlOT2RKT3VOXu4R/GJHsSI8/A0tNPU+pextXVPSiM6VJKeUp3dJHqEeMejLZGFTV9x2zzH5osOjYCuSSLFNt30Dw8x0+EYqfip26P3GbL8vD/AHL3jFlVLTOBtexFwLi0ehBXkefFu9hbbRdN+UexTopoyoxuZw3tsLxkrDor0FQ3vFSoK5UoGwmXVe4Hvi8sOkVqCR0xkpV8WYgxnL0acx3NUHDVJpiEBtFSYkwhLbmplDXaJKdWskk21FNwTY2jyMwoUKNJ1FT1Sk+xvmt723tYu3sO7OaqYswPNS1WwlmPOTslV2vRagkVaWmnGltpIb0JabSGU9mpSQUAHnvvGJgKNDFRcalKzjutpLnzvdu+/aLt9TjdTd+e5jY3SV9y20mYyzYkmxi26JTpLdAB5Q8ShpRiUgWMWZU0UNGqJd6bnmZaXQXXnFBKEJFySTYACPDrpQluY1nJ2QtV6daoeHxhunuJdmlEKqLyFXBWOTYI5hO9z1N/AR5lOLqT1vl0L9WapQ8VHn1GC044zNtPINloWFA+BBvGa0mjz02ncnXFbqJmepdfa7zFTkm5gnp2gGlwfEfTFjLZeLq6H3fI9urJNqa6luK2U1LKLBWI2la35JDmH6n4pWwS7KqPkphzSP8AJGPRlFxnKHY7+p/3XvMNyGNIPqZnEL5WMZ2DnonYqhJqQ5MRSwqNCbqcobvMI0TSEnctnkfMA8/KM7HUvGw8ZDmufcKnoI6uQo+2NXMa4Xv7Yhkkr4ewg1MZWT1UnGErecBVLoWClQCRsUnrc35eEari8dKOMVOEtlzPoHhvhjCVuH6tbF0tVSom4c00knbfpqftRFilEG3I+yNo5nA5XTsU1RVYtDywy3PVFLUrMTLqqDJPmaUwpZLYdIsLDoSAL+Qj0sNCU3v5qLkLtjrmpntnyom4Ji1iZapNI9CDFrBlOlqvm7RJedOilSa1VGqLPJEtLp7Rd/bpCR5qEWKaai7c+S73sUTqNMauL6+/WKtOVCYNn5+bcnHU39XWokJ9wIHuj2q8Y0cOoIp12SQp4Rfbw9g6tYrmk96Xly1KhX3Trgtt7Bc++NPxC8bUVNGUqmmm5voQu2l2adenHTdx9ZVc9bx6Gy2PC3k9T6m83KI7NJUo6+u0UtsrSHYywmsYSepy1O+ksNHs3GzZZR97a3eAJuR4cuUZWDr/AEfEJvzXszGx2H+l4XSvOjuvl6xj0952Vqam1HvoWUL7pTYjnsoAj2GN0aOb7nQuEKoSy0CQoW23+qLLJXpHZW5QzEqVBF0kb7WJ/L8EVLkRyZCdak+zfWSCPaOUVdCUyIsSyN0KcSLWiFck2sKTKZqluSjhu6wdgfvT/bGv5tTtprrrs/sOgcNzjWUsM+a3Xd1946zLIsOhjVvGG/8A0JWKiVTfeHjBHAxb3KGWSFctoqU2yiWC08kXJabCuQvByZVHDxTNptEuDdVz5RUpJczKjRpmzeUty+iMnx6Ln0an2DfGKNAIQym/iRFxwNC+kSMsrjmqSNUZnJVYamGlXbUEjaKJUoyjZkxxM07ofEvnvjRbD8tMTZmEOp0pukDR+OMJ4Cje6MhY6tyY9MNy8xUqoy48hIdCAHNI2K+aj7b/AFRu2XUVRw9+svh0NBzfEOvi3HpHb19fl6jqCRZapeEwVHs7p2233FxHpM19s5WzExA4/OrWFFKVL2sLAbXItzvvErkSrHNVVmTqUbmwJJJMGXSMqpM6pggG/silbg28E4ZcxhmbTqSEqEmlfazykg7NDmPaTZNvOMPF11h6Dn7O89LA4Z4vExp9Ob7kd2PYFqSJdAapjjbQSAhIFgABsI54q8W92dU8Vtsi1WVOKXZZDyaXpQsXSFrAJHPlfwivx9JdS26TGHO4WqMrMuoXJKCkGxITeMlTi1syy6bGsuVStCrDUORi6mY7VxpTcq9S6kmaaTqZJ3FtvMGMhNSVjEknCV0bzYS8G1MrACz9iUTbf70+cTGait+hm0KarVFCL3fLv7PkSthjF2EMI5fVGemKKuv4+mQuVlEziNEnTW7fp4KTqcdNzZOwFrkm8RjKcMbGGrlHfbq+x+j3nvYTMMXk1WUqHk1OV2t1vulfl6SMW6i49MFbz6nXVm63Vm6leZMIxUY6UrJHk4jGV8VN1Ks3KT5t82Lcu4EW0kavvr7xfjUlB3RjK1jZfWiaYDcy2l4D1SeY9hj0FWhUhaauUvcb8zT2G3LIdULi+kpvYRg1I0k/JZacTS9FIIGrbx0xZSj2kWN9mnBOlau+D48vhGfTp0Y7vcqirCshRSLFZFuUX6mMne0eRdu2WrWlLallewG9zHnTnKbuyl2QgOuvT0+1LyyFurWsJaQgXK1E2G0W2yy25OyOiZZyWymyPdfWtJxHPA6CmxJdtYkftWwdj1WfIx4VVvF1lBeavv7z146cNRu+bOXgX6jV1urJW66u5J3O8ezbSrI8Pecrj9kpVMtJpbA5DeLDdz0Ixsij7brUyiclVFEw3uLfdeURs9mQ007o05yUZrd56ngMVRO78vy7Q/fJ8/Lr7YRm6Ts+QlFVt47S7DLRZnDaZNbdflqsZzXZv0B9lCNI5ghxBOq//CNgp120rW9dy3GbWzJ6pOUC6pgSn4jlcO1cUWdljMS81MYikGgpABO4LdwbJJsYl4+MZuGpXXS0jKUthRrmSE5hvBVRxHV8K1eUpUiz20w6MRySyEagkEJS2SbkgC0KWY06tVU4Tjd/7Zd/aTdWuNukYRoVbwQuuUqlz8+yiYal1yreJJT0tC3XQ02Cz2WoalHbyueQMZs8TOFTxcmk7N30ytsrve9i4m2PySxRXMh11GUkqLUaWidm1NvzAm5GdQ44wSgpDvYKta5sLi/MXG8edUo0c0UZSknZbecufouU6pdGIOMc/ZnHODF0DEzVRn6Yt5D3ZpflGlBaDdJCky4I5nkd4uYfLYYSp4ylZPl+s/8A+hql1G7QME0PFGF3KzSZLUwy4lM0zMYul2npVKlEBx1KmO4juqVe/qpJttGTUxUqU9M33eS7P0Lfdkbve5vzmW4kJymszWCqmE1Ct/NEnMDEKCy6/ZCgQsMaQghxOlR572GxiFi1JNqa2jqfku9t/Tz2KrPkxn4upOHcG41maBVsOz/zgwlJcDNe1JGoXAuZdJ5eUTCtOpTU4yVn6P8A9FqTsM2cmaBUJUydDw7PsVRxaQytyqduDvuNAaFyem/nFipX8Wm5Ney32lrVd2XMT5qelsLSbsvKuom8QupKH5htWpEoDsUNqGxV0KhsOQ6mNdk5YmWqXm/H+wlJUFZby+H9xiJS488VKupxRjJ2SPPV2KbclpRqPM84tuRdUSS8OKVW8sJ/DxOqpUxZm5FPVbZ/TED67RhT/J1lPt+J6FPy6Th1QmN4iXTsD1+jKS07KVRtoLbdSSpDrK9bTrduSgCtBJ20qI8Le1WreM0Sit90+y333Rcp0qLoTqVZ6bbJc5SfTbou1kh5JYFouOKzieaxD6QaPR6SJhSZZbiCp5bqW2klTbbigN1HZB5RblVlSUXBbt29131XxMWnaRrYhmaNRM3axTKShaaUwoMIS66t0myRquVttqO99igH642fB1bwWvm+f3u/iXLJ7DBreHUkrnqP9lYV3lMJ9ZH7nxHlzEYWKwD8+jv6PkWZU30GUQoEpUCCOYtuI15pp2ZavbmOSXxZW5ehCQRNqLSQQ2pRJUgEAWSb7chHmTwOHnU1tG+4bjDPMLgXhKdTa1lL9ZLbZPpa23YN1S1LWpaySom5JPOPSSS2Ro06kqk3Kbu3u36RepVAm6k4lxf6Ekge8+sWv+5HU/RHo0MJVq+U9o9vyKYxbJaw9R1VjEdGwjQGwl2dmkS7AUfWWs21KP0kxn16tLD0mo8kjJirbIVcb4bw1hqnoepGM2sQvonHZWclxIOS6mVN81jUSFIJuAQb7co8Xy5q7i4+x8/tLmq3M2ZCjVWl8K07iaUkvS2MSzXo8/UJZxLgkJRlWoS6wDdC3VgKUCB3UDxMejhVSnWUG94q9u2/X1faY99UtyGpWVmK5iVthlCnVuOBKUAXJ3sEiLGOxEbuT5IqinUmKuYk4209TsD01YUzTwVT7jZuHHz63uHqj2R4eHi96sub+BVip3apR6cxoJlihDCEpskqCSbeqIv3RjWtsSNRMDNvVhj5ynUplD6+lwX5bRizrpLZGbGhvvyHzMZe0qUqMu9SqrdIXZ1JUFBSbeHt6eEWFidSepF9UVF3TIGxVRnaRi9xQuhl1VjrR3dfSyxsSQL2O48+nQMDXWIw6u91s/sOaZphXhsU2uUt19vzHFhOoqZmAhTpTYjYKI+mM5o8O7J9lXETtDvp1WTtzPl8IoXMnqRniaRIW4qwItc+cVkIh6qy4elnQU8r2uInkVjCobiZDMqVbdc7Bh1zslqI2AVtv5RZxFLx+HlTfVe/oerluLeBx1Ov0T37nzOrZfKLETzDqlOS7RS4UIGu+u3UHwjmHjqS847nVxU1tSSt2idO5V4ukwoiXadQN9QVF+NXDNczz3i8Z6BoLGGqbNqlqtVHjNJJS4iWZuEkcxcxfdOT81FlZnKD8p7lipjBCj3KvOoH7aXG0U+Lq9g/xOD/APC0uYOIOmvPpP7aWhoqdhP+JwKXwn+yFf8A/bmJ0T7B/icO0ZSE4SbV3lTz4HgQIztVXsNX/wDjrtMoncHtm4pM0/8Aupi0Rar2oq1YddGKVLm6DP1dtmUoCWNA7RTq3SogJ3+k2EXKVKrUqKN+bLVXEUaVKVRR81X+/rOpcuaOp55pS06indZtzP5XjerKMbI5m23dvmyTcfVJFPw0WwbHVawVvYesd+XIRZ6lvmcLYtqa5ipuqXsOXK3j16A/gisuxRDtZmQlCtx7ojcrI3mXi4+olWmx26AQB6EcMmTbT3D8MY1FxyTqtbmNcosJFxLNLIQfYpQUfYBGgZ1jv/kKjHdR597+R0fIsHowzrPnPl3L5nU1QpOJ25cehIl57SOROkmNUi6T5m3NyQzqvjDG1Olww9QGZVIBTruDfa3OMmNGjL9Yx259hEdUrtdeae0yLDbiwbLU7exPW1ozYU4J8y05S7CNUUlctJBLig64SStVuZO5jP1K+xiqFluJ0zT0uNrQtAUk7EHrFSk0W3BPYaD9GfknnFygL8sr12Cdx7PMRkalLvMR03B+Ty7BPeQpSCokqHqkqFj7FDoYuxdlYqnOVTeTv6fmJikqQq9jb6oqMV7G/LVNbaglzvo8eoiLFUZ2F9meZdF0LBPh1imxkKSaNaacvNE8hpG/jEFLe5rBxQIOq0SU3Fdh8+iN3I5RN2XE9jWfqDLdyFalfepikhzSEpTs1UJ5uXYaU66tVkNNpuSYq2W5abcnZEz4YolLwXQF4mxA8lU0kENBChe9t22/FX3y+SR5x51WrKq/F0z0aVONGOufMiTFOJ6hi7FC5yZIQyLIl5dHqtIHJKR4D8JJ3MZdGlGjGyPPq1ZVZeg3aPTQw0HXR9lV08ISk3sXacLK7HENh4GKLJGWWK+MQQxKmpNZcExLr7J8Hp1itNNWZYcXzRpOTktOuaKo36POC32cDZduWodfbz84mOun5vLsIc4z2nzKzD9QZZCJWbfdkhshtubUtCeew38zsQDuYzYV0+XPsKJRlHfobTC8VT8upDEjW5xpQIKW2n3EnxG1wYzY1KnSHuMZ4inHnJL1okLDU1mxh+lScvh3CVWlSxUTPh75kU4p13sSynWFpKVBKFL0i2xWo84qnCVS+um3dW9XP3lKzDDL9de0WsWVHOnF9FakKrg6qsSCKiuoCXkqKppHbrQlGuwHRKAAOQuYilSdB3jB3slv2K/zI/xHDP8AXXtF2pZpZ2uYWmKVNYH9HacUC6+MKHtikL1lGspOxIsetuREYywtpqajLbvtysR9Owrd9a9owanmRjJzFC6nVcKyrfaV/wCfJmTfoi25aYmA2G2w4jYKbQASlHK6lE3vEpShDSlJWWm/VL2c2X1ioPlJe1FZ7PPGc/LuSz0vIDVOia3lSVJUl1T6E3Uo3Sl1anAD1NiSmyYsLxcJXSfK3us/dt/cvKtNrYb2IqpV8XVGXrdcVKUaWRKol5dtpgtMssovpQ0kkqVupR2vzO4i268YR0Q3fP8A9fIuuNSXlT2Q0ZrEDUlJOyVBQthLidD845+nPDqLj1En70c+pMY+h1Hqqezp/ctusoK1Jevr/YbzUs485qI3PMkRebSMVRuxcl5RLSRtv1i03cvpWN4IBTa0QVGWQnpqi4glqpJ919hYPPmnqD5ERTKKnHSyqMnTlqQ5sTUqSn5BFfpCf+Spw3KU7mVd6oPle9ojD1LXp1Pv6S9VhGS1x5MZ9Hrtew3MuuUqqT1ILncdXJzS2Su24BKSL2v9MZzW3lK69O5gpuO5e9UJmen3p2amnJuZeWVuvvOFa3FHmVKO5PmYrU3F3RfTT3NlmozDKbIcI8o9OljpR2luXFOUSyYmG5pWp9oLX99bcxXPE4er58biUlLmjS9HlCeShf8AbRi6cI3yftLXkinKGTlyFolkLcHJS+9b4xlQnhKW8Y7+0uRcV0FY1J15wF1QKANknkItV8YpqyKtWoUqFiSo4axfIV6kTXodRkXg9LvlIVoUOtjsffHjzaqJqW6ZWpJFuOcx8QY5fkm6q7LJlJPX6OxJSbcs0krN1q0IABKjuSdzaK4pQjZe93+JYlO72EqhVvEUhQatRqVU5iVp1UQlE/KoXZt5KTdOoeR98XotQ8t9ORCTbsPsKawBg8TAQHsYVBoiRYI3lG1Dd5Y6KI9UdOfhHiTk8VV/2L3noXWHht5zI4kaYtC3H5hZemnTqdcPMmMiUui5GHGDTu+YvSsiuYcWhhlUwUW1hCb2i032l9RvyHXTsGVmfYU9L0x1SAbEk2izKpBc2XVTduRutYUqLbi0LpswhSVWUDfYxT4yPaXFBiXjDDrqMATDrskS6hP2AOMlff5hW29xY8uhj2sqxKhidN9ns/sPCzjCutg3Jc47/P3EO0abclaiLW2NtSHO6fME9PdG7SjY5mdL4Tn0TMs2lxSSFDmd/rMY72J9JmxNIa2SpKTbndXWLhBA9Xli3MrSevKJ2K0RBiCXUzPF1HMbgwT3JZ6CZcZiU1zhlw5iyp2fEg8iVnEne6wAE6vIgCOZ5phJU8wlGC2l5S+33nWMrxca+XxcnvHyX6uXuJBTmthHEsrLUOXWll15+6H5m2oE7BAI6bx48qFWmtbR7EakG+ZxJmhSJKgZ01mWn5VxaS6S2G16bX3/AAmNppydTDwmn0+B4WIjCFZ6kR8XaCeUrMp/+aIueWYt6T6FCaGRsiaT/HER5ZT+SLdFD8Zn4iKvLJvSFtGDJm6e3rVNYHW79/qiw60exl7xD6tF/wCZKkNq/ROLZJFujaFKh419IsnxFNc5oc+HqHTJWpsinVE1b0hXfd7LQEhB5Ae0j4R7eWxlOo6kla32mvZvOFKjGnF31P3L+52pgWmiSw56QRZVr3t+W0bFJ3NKZEualcWtcwnXpAvYk3sLbDnudyfbCKJSOQqu9qWtVxc8zbflEsuoieuTZLihcc+UUekkbMjKO1fEVOpTFw5OTSGAv7wqIGr2jc+6KZzVOLk+m5cpwdSahHm3b2ntHhjEuGafhGl0SmPJZkpCUblZdB6IbSEj42v7THG60atSpKpLm3c7bSjTp01CPJK3sJJouI5NibLqXG3UqTYWsSNvOMOUJF8K69SaqktpbD102cKkABXnaJheLuU2Imbyxl6/MVEUqfbbcYPeaWffaM9YjTbUizKCGg1lLUpjFfzbMPNyyDcJeT3kk+EX/pMVHUi34vcb1eykq9PnXGpVxqbKel9JPx90XYYqEluUyotEX1XDFVpgPp0i6wn75Sdj7DGdGpCXJmNKDXNDSmKchRKlNjURY7b28DF5SLEojdmKEDctrIHQKHKLyqWMeVIQ3qFNIJKAD5Axe1plh0pGmafPoULsKJHUGKroo0zXQyJTUE7aHLftukRsybTMg9OI3Tb3CI2JtIv7CdWO+pXvMLxFpMqmnOEDUTb2gRLasToY4qZOzNJQPQpSXQs+u4sgrX5E35eQizJKS3ZfhJw5IurNQqFdmQ5VND+lOlCA5oQ2nolKRsBFMIQprySZuU+Ykty6WXNbUs0hQ5HXe3xi62rFpRtyQrySK3UH0s06Tcn3SbBEs0XT/wCUGEaTn5quROtGmrzaXrJNpOUWa9XZQ4jDwp7J5OVB5DP/AJblX0RmxwNZ81bvZ5082wsH51+5EqUXhsr74SqvYplJPxakZUukfxlED6IyI5ev1pewwJ510hD2slOk8M2FUKSZp+q1lzqFuhlB8dkC/wBMZMcFho87v1nnzzbGS82y9XzJJp3D5gqV06cF055YtZU432yv/OTGTGnQitoo8+eKxdV+VN/D4D6kctqRTUhuUptLpqR9yxLtN/6oEXlJLkYrU5c3cWfmCVZSQuptJt0CjE62U+LRjcplIbT9lqrKlC5I1C+3O4J2/tinUydKNVyn0BLljVGgSdtxubXinUynSu01Pm2jKBLdTQCm2oJNje17e3yirUwoq5ov0qmKBHzmyRa3fVe1rX5/kIqU5DREb87gqhT4Uh2Wps5c7pdYbVvz3BES5vkwk48nYY1XyUwhV3Nczh2nTKnE7LT3VG3mDyi1povnFewyFiMVHlN+0jOp8NmDHHFGXpc3IK6ejTRIBPkq/SLToYaX6tu4yYY/GQ/Wv3oYlR4emGEk0+tzDNuSZqWCh8U2jGlgaMvNk0Z8M4rLz4JjKnslcWSpJlH5GopHLQ92aj7lfjjGll815sk/cZ8M4w78+LXvGVUcFYspIKp3D86lA/xjTXapPvTeMaWDxEV5vsPRp5hg58pr17DVccQlwtufY18ilaSD8DGK6c47NWPQjOE/NdxQolXfos+80EonKTMp0zUo4rYjxHn4GLNSnrV1zRchNwduaZiq7FLXPaqbMdvLrTcJcGlaN7lBP4RzjIpTqKNpoTjC/ksbK2nWFXR3h4D6fdF5rqmY1mmXJmh6qwQYttEqRnDyFIOld/KKblWpFQuyr7EwuLmcPpCQOUQLlFTiEjZWo+AieZOpGMuvTP7VsdL2EX4U5S7iLuQoy0oVp5BDRPeWoc/Z5xelOnTVkVKN9uhJFBnKPRaSZxuUM9V0m0u08j7C0f1xf358E8vHwjxa86laWnlE9CnogrrdiS9209VX5+bdVNTbyipx5w3UoxCSSstimzbbfM2W5a5G3uiG7FaQu0WZfok/NvMSyZtEwEktqVbSR1vFmcVUS9BVHyG7dSQaZmHWZCWcaYoaVNr5pLo684xJYeLd3Ivqo+w2fzfVpx95w0RQ7Q3UlLqbRHiIftFXjH2CRXKzV8QU5iRNHEpLpc1uuuPC9gDsLdYvUVGjLUpblFRuotLWxzPVpL5sxW+3qSllSyQLAK1XN9SR4nfUBY3jqNKfjaMai6o45iaXiMROn2Nkr4GqZSpCXnAenPp8YhmOiZKg03MUhK0aSSOXuiIlJA+JZItvrsn2eyKyVzIhrsp2jC16b90wsXCQsjqwZnAWYmBniFuPyHzjTkLFx2rCtZAHmm/wjwM2paoQrL9V2fdL+5tOR19NSdB/rK671/Y62RiZFc4f6ZS2sNUl1pxht1ueTLgTCDsr1r8wRGgQUqdV3k+46HZSgmkQrxCyEqrE1AxDMNKdlp6RQpzszYlaRY7x62Ak3hnBc0zz8bGOpSfI5y14fV/7PNJt/wB4I9H8p6Dyr0exlivmMqBSJpI63UIny7EPxXS5kCqHb1pn4CI8sq/J+k1maHWnyOypk26T1DKvxRU5R7ShU6nYxUZwZil4XRQ5kDn3kBP1mLbq0l+sXPEVn+qS/gGlEVhhgpH6GQGVW++5q3/dExt+Bhpwyf7W/wB/UaRmdTXi3H9lW+fvOxXFopmBtATtovYdBb6L/hjJe54kjjLH9X9KnnCpwKUpdz0B6fAfhirkiuKuc/VaYVZRK7A8oO7LpE9WfUqbJAGm/WIBv4IUn++hTXS2dbLingT10oNj7Lke+8YGNdsNL0np5fG+Mg+zc6elcTPtEFLqkW8DGnOkmdDVZodUhj+pSxTonF28zFiVCL6F+Nd9o5HM2ay3I9mmaUm4spSTvaLCwsL3aLjxDQ88B41RUMWVEyNSVQJVwJUhEw/rW65pAIv4E7xYrUVGC1K7LtOprbJgmMW1aVkJZ96fl5pllepQasCk9b+Mef4qDdkZeqwiVXMCUma/qLtlKG5tty8R7oqjQkkHUiwmazJ1KkvyswlLiFJJ0q5jryNuh/HExhKDTDcWiFm8Py1TXNmUmNDjThSUncc49Zz0pXMTTfkNSoUt+SfKHWyN9iRsYuqSkWXHcRHGLgDT7YuXLbRoOMeI2EVJltoa9TqjEs4pphIeeGxPRMX4psxZ1FHZCKl2cmTqceKE9Ep2EV2SLKcpczabl0C1yVnxJiL3KrG/Ly635lDEswt95RsltpBUonyA3iUm9kTdRV3sSrQMl8xq+lC2qAumSyrfZ6ksS6QD1se8fhGXHCVp9Ld551TMsLT637tyZqFwuvLW2qv4kUomxUxTJX6Na/wJjNhgYLzpX7jyKmcTe1OFu8m+g8PGAqWWXFYaRPOpAPbVWYU9fz0khH/ljLjSoU/Nivj8Ty54zGVfOm/VsS7K0bD9Ep6W/S5KmyqBs1KNpSkdNgnb6IyNbtYwHFXuzRfxfgemqsp1U2sGwGr1rHp4+cR5TJuhvTedFAkbGn05o2O5JuR0O9j4X9h84qUJMakNWdz9ninQw2lu5Nkjb32ttb6dxsInxT6hz2shmVDPDEEwlQExb74m3dAPTz9t7RWqSKdTGlNZqVx5SlmaWLbklRAsLm1/Abe0kxV4tEamIT+YVaVYLm3VBNyrSSL+JNzyte17k36CK1TjYhtmivHVYKA2qfdCAAFDXZI3PIDkB3tupvtE6EQJqsdVcPalTakqICtkp7oJJ3JBJURtc7j4RKgn0BrLxvVbpvMrA02Qkn1efwJJUdhEaEDGnH1XSEhM4vTbo4Tbfpvuru8+Q90T4tEmROZFZSO9OOJsLae0IT9FhbwHWxPK8U6ERuKLGbNfY0pRPLWra99idwRyt4bJtawER4tMq1MWZfOyuMJClTSnTpGoKV6uw69OVvO535RR4pC7F9jPOZW0ht9pD61CySpAJUTzNh53sL2sBEeLfQm4uMZq0GeetMybYUVG4Qq5CSR4eQO/iYp0SQuhUaxZhedQlKJoy7hACgVWSL+PhuD8YlKSFosrM0vD1fZ0u+gVRki4Eyylexv1I8jEan1Ko3i7oZFRyiwvMtrWzTFyZWBYycwbC/gk6hzNuUY86GHnzivVsehTx2MpbKd+/cj2q5MuNuLVTKohSB6rc5K2P+kn8UYM8BF7wlbv3PUp5zJbVIX7iOqnl/ienBSl0RM20BftJQhwW8bDf6Iwp4SvB3tfuPYpZlg6vWz9OwyH0NslSJin6FpPeSpSkqHtB5RhvUnY9JOLV0aJFMWoBSXJZXioXHxELsp8g2RSW1oC2nNaD90hVxEKXRlei+5kTRUEbuqHhyiHP0E+LNxmiMJUFalqIgqunkitU0KTVMYStJKCbcrmEq82XFTSFFuWSALIjHcm3uXUkbqGtht8BFBWbrbIvytFNyqxvttCw23ih3K7Ciy3uLiKW3YqFVhux5bRZk7lSFVpAKhtvFtlYpNSzztkttLX+5STFNwQNmGyEYpbZ9GKC03qU8AorCTYKA/agpGob+sDHSstbeAi36TlecJLMJ29HwMWFpqXZmW9UyUgkWIWCn+yM9o8M6MkCJiiJQlV7i4Nt/y8xFpN3JvuRviqSBLtkkjnz3MXCCEqlLgoebUm/PmIl3LqGRhOvLwfnpRqwTZhuY0TCTyU0rurB/ikxZr0lWoSpvqv/PeZOGrfR8RCr2P3dfcdOyE2ZfAQp6XCTIzz8skg80BZKfoMc3lD8s79dzrMJXp7dBTx1pxFwo0yZUdT1Kmyws9QlXKGF/J4mUe0jELXQuczCn0dSRaqLB6gs9Y9dSl2Hi6KfaBplNKbJqwv5tGGuXYTohbzi35rkv8A3s3/AKBhrl2FPi4/tG0rGGInBY1V5A/aqtFDo0+wr8fVfUz0ys1iexFLomKnMraB1ugum2lIufqiqNKDdkiFWmnqb2W50plNTjMONzDgupZKyoeJuY3rSoRSXQ5nObnJzfNu5M+O570TC7jYG2kgbbDr+XOLdty3zZw3iic7Soud4lST37m2/wCVhFx7IuRViJKy+S2u9zty5mKOpWRjPoUuYPdGona8ALuD3w3mBIIUldlNuISpad0gp2BPU7E++PPxqvQZ6mXSUcXH03JpvvtGrm8BrUDcKIgU33Kl9wItqJiLIXY9sKS8rOUuecmp1Mn2SLtLUu11fhizVduhl0d0xeqEzP0R9mnqqy5lLiQt5ttRCNtwOe8WVGMnexecpRsmzWlsUPyc9LvtFsutq1pUtO9/G/X6ol07qwVUlNrOdyakVNVqhSNSBQR2nYjV8Rv+W8YTwrXmyL6rx6oSctaxIz2Na25UbNSqklxLYXpAPgPqi7iIuNNW5kUZ6pMXMSVSmtVBUulGlK0aghwglsHlfzizTjJq5elJEYVGaYlVDW2tJJvYpsQIzopsxpSURn12rtt0wNyq7uOc1D7kRfhB33MSrUVths0LDtcxJVUSlCo85WppR2RJy6nfiQLD3mMyMZS81XPLlOEN5OxNUnkbiaUq9NpmI3mqTWZ5vtZWhStpuprb/XVNJISy0Orrq0p8NR2jKhg6k3vsYFXMqFJeTudBYR4YqGzpmcTPzVWcO4lW3eyYb8lLFivztpHtjNWEoxe7ueXUzTETjaKUff8AE6Ao+DsI4Uk0tyElTaGgWSr0VpKXCLdVeseR5mMtaY7RVjyZznU3m2+8rN4zwjSzfWZ11IBAJFjY/VaK/KZZukM6o5z9ndulSiGAblC0pvtc7fWIqVNvmNRH1TzQxHPJ1enOt6hcWIFr9DaLipxKbsZs1XanNzX2aZK7m9lm/Mbn33+iLqilyKXdiO7MPuqJWsq2JNz62wA+kERNgaalKLhupSkgEE3N7AXPuJ+qJaBgWClKlLJuCNR5XNv7PridmgaRTcJSTdItr+PL6bW9vnFQNVWrQtSrahc6Sbg2BuPYDb2xHMGFSU60gnUnXvfcq9vne1/hEpg01aipBSSSQCbb7nUfjdQiQaLiyVLCQCvSLkEjlt15bp9pvEN7g1XhYKAsfuRfYajy2+m/7YRK2BqqsbJSo7jSAfAq2ufYCbfjiLIGotwX189tRCtxt+Ekg/H2RANVSwl+xvrGx2uT0J398Ha4MC3ClFiLlIOoHxAA5/REIGMrWCoFZKL95RTsbc7nnbbl7BAB6W+XLKdUbHckXAsOvTrsIE2L2qpMoCAF94JJGkbJ33Ph18IgIVpbFNUlEJIfVqQDpANgNrC55+J8yYpaQHlTc0K1KEH0tXdVcAqCU3FgPMgG3t3ilxTJux+SGbq1ND0tCXRcDW4gJ5WA29gPn7Io0FVx2y2OsNzzCVvI7JVrqKeYAA6eJNvifCItJFWxszlLw1XGdSZpCJkHS0+CG30HYbKtfn0UCD1BEW3Z+cipSlHkyO61hvBEhMsMZk0qUpFImX0MSmOKIn0WVaWs6UpqTKbtyxUTYPoT2JPrJbjGnQpy8pK696+Z6dLH1oLTf5f2Nyu8L+JaLOLewzWEvp0hYlaijRrQRdJS4i6FpI3CgLEEEGPPnhIyV4v2nq0s0cX5UfZ8mMKo5cY0oxHp2HJpSf12VT27Z9hRe3vAjAlhMRFXtfuPbp5jhJ7arP07DZLBad0OpLTg5pWNJ+BjAkpLzlY9SEoz813M6WthcfGKHsXTYQyOvxim7JFSSp785NIYYaLjijZMUOSSuytRbJNp+Wk0uXQ7OTaWSRdSUp1FPv8AfGHLExWyRfVJsdlIy5ok1PtyqZ12eml3CGWrlSrAk2AHgCfdGO69TorFeiPaJkvgyjzmI1S8vXZZuVWQGQVnWrzN7AeyK5V5RjvF3IUE3sxdxTgmlYNwWKjMPrffcfQyyhS9lKPXboACYt0qsq07IqlFQQ4MOt4IborD8+3+iCN0pAsTGPOVfVsXUoWJBM3SZGhzc9LYdKJWWRqW66i1u7qFvG4ItbximlRrV6qpxd2+X3+JZq16NCm6k3ZI4BxO1N1fH1SnJgONLVMdswkrUWkpWkgp0/cnlfmLg+cdoo0o0KEaS6I4via7xOInVfV/+GWk0Yynfli404d1WUU7H2Aj4giK27mKS9h6YW3KNNu6RcbCwSbe4AH6YtMk08SSoLLiiLg33tzuOUVIM57rDOieWdzcX3iXyKlyIaxTK2WpxPM35RKKnYm6g19VQwCzOFwFUw0yt0f94GwhX0ov740jGUVTxUkjpWAr+NwcZdftWxJ2FHBWcmsfUNRu6JVuaaT7CQT9UeRLyMVCXbsevB66UonObdBnJhgPNPy6UKJslbwSoWPUGPWc1HZniqlKW6YKw/UkfdsEeT4MPGQHiZox/MlS8G//AM4ROuJHipismp4TaPcw65Mf5WaV+CKNNbtLinQX6osMVOlTdGnfm+gMUpwaGg8hZUo6zYjfyEZmCpTlio6ne25h46tCGDm4xt09p1rlXJBrD6XQOSRc/AxuMtznbEzNKqlthxBVZIQdirnva3Prpi1FXKDjesvlc0vfqeQAEVvcvrkR/UAHAQbm+wAFyfwRRbqVDZepzihrI0A/e7qPv+ja0SBdwxh9xzE8o5pc0pBFmjvz1Dc7XBG1wRe2xhKEZRcZcmTGcqclKPNEqTtPnqc4hM7LLliv1FKSQle9tj15GNPrUZUZuLN/w+Ip4impR9foNKMcyHzF2iUaXqb63ajUE0qltH7NMdn2iz+1Qnqr6BFuc9PJXZdhT1bt2RLFPkMsWqW2uUwBirEibWE69OLbQo8rgNosPjGE3i5PnFGao4ZdGxh4lbpYqbkxR5KepYbToXJTrxcU0PJRAI9hjIp67WlZ9xZqKHOIzVTLmoqBUN/G8ZNjFuyip7S0QVovaw3tEaSNTHngqjzNamVtMS868+pfcVKsLXpHU90Ek+AimUKklaKuXITpRu5yS9Z0JhDJDMheMpGosYPmajLlVwurAMJb8FkKNyeoFjFSwmIqR0paSzLMcFSd9eru3J/e4OcZ5gzUpM1Cbcp0wb+lLk5QvFy/gTpSPpjMoZc6e0pXXoR5uIziM/Mh7X9hOWD/AJP3B1EYbnK3RzVXGyCp+vzmtF/8kjSj4gx6niaMN9PtPDljcRVdnL2ERZ35r4Yy7zC/vC5Gu0urZmhnVXaw1KJ+ZsEMbfZXW0DTMTRBAQz6oJGq52GVCLn6EebUnvvuxi4exJhjAWHZyXoTb1Wq868H6vXaoszE/WJkgan33DuSd7IFkoBASABF/S3stkjGvvfqJ9UzRrs8hQS76OhXMITt7PyP44qVK3MjUxkTVeqs2oqfmnHR1uSRF1QS6EXEsuLVMKUpZLhV3lE8/j7IrtZEGIIGptJ31EA7b8/7YKwKo9UbFOqxAPI3Ow9uwiAW2SEqBUdAJ3SbbD477nbraKgYXkkawld7bd3r5j4mDBYUkptqAX6978rkggjysfpEAa3rquU7AAqGm/UHcDzPL2eMOgNdSBpNkhxO6dN+m1h8RuehPWANRxBCTp72xSBbcXOxt4aiNvBMAa8zbtSrmAbghVr+H0En+2JBorOgKJuUoJsE73ANh9A/DzgwJ7iTpUgqJTsmxG+21xbnz+MHuDVdvsq4CyokEdTf6rxFgaa0g3DaCbalAAc0+sNvPr5QBpOFepNrggqNj1skG/kbkGI3BrG32QX0jkT5Hlb6vjEoGs4QGXDe5BN0kbp3T18d4jkDCvcLuNrn1RueQ/F8bQ3Bjcubm/fuSQD1J3+FrXiEDHZN1E7pF0gatud+fkB8YcyUUcskFNwgiyjc78uvxibFW5agEEWTv9XQ/Sfj7Ighs2O1WVAA2Njcg8z1t5bm5iBbY2W5pxu6gpXdNyLmyQbkjnz/ALYklihK16cYAHbqQrYknnba/wBQ897RTZAc7OMptymvU+eQmckJhpbT8q/Z1LyFDSQq4IUVC45WSLnoDEWs7odB8ZD8Q68iMaSWAcbTPzlkXUn+zos7PqU6vCEws7NKXur0JauV/U9YCwVqwqtKz1w9aL8J38mR6eipYDn5pUvU6G7TZkWC1srChuLggp2UCCCCNiCCLg3ixedtty55DNOey4yzxIjR85yjgVyRPy6V/SoRU5ytaSK4qzvF2GbOcJ2DakpblPlqa+VDb0SbWzbzASqwPujHlTw8+cV8PgZ8MZjKe0Zv4/EZ8zwaqZBVLsVEp5jTNIdB/wDKNox5YPDS5XXrM2GbYyPOz718jAjhmr9MrDD0kl9lLSCktLlL6ibb6gdjzHLrGDUyuE4tKo/Z/wCGfDPakXeVNeptfMuq+SeYUzTHJaWQGStQ1KUw5fTe5A39kYkcm0u+v3GT+EEZLem16/7CvhPK3GuGFNzKsHylXqqXFFE8qYmGuySUFBSltI0nne5iieTVJO3jFbuJ/wAepW/Nv2ohbF2SGN29SnaJK0BCmQ2wpHbFrX99qVc38vKM6GWVes0yw89or/63f1DZnsqswqxhSkyNWrEtOMSMyVFxOskpCSNJBsbjeKoZSoSbUkr+hlMs/i4paG7elDpkMMzVEpSv0EyHmxpQ46ntVXva4BIT7zsOcI5PTbvOo33K3zLE+IKrX5Oml3u/yG1V8UTruEAibqXzgy40EtoBAC2xZOpNuh6HY2T5x7mGwmHw35qNr9epreJxmJxjvWlf0dEQ4+GpqcUVJGpAupw3IcHMk+8i9utzHqHnCxJyUsgkLSytq2tCXDz6lKVggg8iOu3LpEXA4ZaTMtMqLK0qRYKUm5KfC5HQ8twLHxiNiehdV2Q9TNWkpJ20Efh6wXYQc8Ykl9Myo8yPKK7NolMiDEsvrk1qsCSDyiC67MmfhjwCzmu5UMIJnzT6pKzIcbWbFJaWDe48lJ+mNRzur9GcKjV01Y3bIbVaU6T5p39p15OZL/3ol1OUnh86PVSW0S9QQSEBu/eTp6G8ahLEPEOM4vZdDc4UlTTXVnnlWaRONYzqcpLS7j3YzCgQgXsL7RtClHTdmt1KctbSQmGm1Qc5N8W/aGKtUO0t6JroW+g1K36lf/0DC8e0aJ9guJwu6lQDtVkGR1u9e0WfHLsZe8Q+rQuyVNbk1U2Sam2p3t5suKca9U6U2tvzsTHuZXeVSU7clY8HOPIoRgne7v7F/c7ewPLplcDh0gpJT3dx4D8N42CexpruQHmjPpdnHQkq0pAJud7Wtf233+EUxugjmmfKlOuE2F1bC3IRDb6l4RRKhx24BuD1H5WilcwbfzclSSNAsNvy+MVAc2GzL0+vtF1BCEgDkN9t9uXjFyytsW79p2LgKpYNrEgqnYgZl3WHEgONvoS6hwIFgog+AI3SPMdYxKlPUt1cu06kqcrwdmSa3kdkdVCuaXLsSwfV9hEpPOtI5ckjUd79PoEea8LSf6p6kcwxUf1r96M05kbk1R6dTxadm1zEwliSkZWadmJmeeWbJaYZTu4tR2HQWuSALwjhKLlZRv6yqWZYy3n27kjqDAHBRiiboklM4gxL/e3pLKbSGF6NVH5uYl0lRJMxMlfZ9oeqGmylJvZaucXZYTBbt04yb9C/9LCx2Puvyklb0j+XwB5UTMzMTFUedq01MOlyYmJ6pPrccV4k6xf2RQsPQirRhFJFbx2Mb3qSFGT4EcgJAoU9RqQop6vJUs/+ZyLip0kuSLTxNeW7k/aPSn8NfDxh9SVGQoSFpt+lSMuDt/FJidNNFt1K0ubftHjL0rJbDrIRJU5cylP3LDCtJ+ASIqvEotK9yj2YmEqWkpo2DGkrB2U+hKd/r+mKdXYh3sS3s1MUVGXUKUzKSTF9P6FSFWPhe5sfKJ3fUbL0nAvGTxNYpyxwpS8CYTqD1XzpxektUSTKysU2XUSlU64L921iEXFrgq5J3iNNTlYObSOF8B4LYwNghyRE0uq1uddM1W6s8Sp6oTKrlS1KO5AJIAPjfmTHpqKirIxG7seyTd26gFpHUi17ef5coquC4NlFyQbFIBUNxcD/AI/R4wb2AIV0273W2wI+rpAF5Burci3qkC/mCfxRSwXbNoRe+m2pO/Ibnl7LmALlakFVk61p3IvzuEgfWIXBYVFAN9R30jawIG3K3h7/AIwA88v8vcSZnZm07COFZNM3U5sErccPZtyzQsVvuKsSEJ7t9iSVWAN4OVgKub+VtUyfzhRg6sVSQrM4KezOKmJEKS2kOKWEoIVYhXc3v0UD4xClcET6AAnSCtW+kC5Oom+3jcbX5i0VXBY62pC+zW2UqABAUkggali9vyvaIuDQLTqUBYbVoCkpJ0HSTqsN+RPO8SDRdZcbbZSWlp12CQWykr5WsDzsLnaJQNNxspmQ0+Ftr7ocBBCgCdyBzO3I9TeAO0ZXhuyWzRwbPDInOicreOJanrnU4cxJTxLrm0IA1obIbbNwRYlPaJCinVpveLeqS5lVkcJLQtTgb0LDxNg0UntAQLKAT4jcHwtFwg1nmHQ4EKZWlajcI7NQULpTY6bX6Wt13vC5BouNPF5YQy4pweuNBOj27bDbr0iLg0lIcTLBakK0KOkKKTY23vfkb6TfwvEAxOsONpIcbUyDpsXUlG9xvvbwPlcRAMLiFNltLqFtuFJIC0FPPwvz3P0CJuwaqjpSEgki/Qct+nx/DDZFSRapSlqCQm+o2CUj1r7gez67wuTYokakE6kkq5/Abj6YAtuQ2DexUCLdfG/0n4RAsjKkgG5sbXG/K4Nz9Y98CNy9Nym3IJPM77AGx9u94dSrkYNRDilEAEK69SPH33v7IO6ZBmPeQUi9uvU2J395Fh74knqY56SlKpQX6XPsImZOYR2brLm6VjcfQSLHyvEXI6nRnCdm/NyGKJPh6zAnlzs0yxfLqszA789LC6jTXVfriBuz5Xb5FsDz6kHTd1yZfi7rfmTHmxnhWsus3k4ZpOAZeuy4pzE4Z+dra5QO9qVizSEsrJCdBBUSO9tbxrjTlJXuQ5Ri7DSkOLLETTl3csEoI9X0bF9hf+PLiK/ESbtdEeMXpHzSeM+psBIXg2syxPIS+JpR0G3tCYo+jy9HvKlWXa/cO/D3H03N0BdQFExMx2Tzsu7KvqlXJlt1s95tSA5soixSCe8lSSNjFvxEuRX41Me1N4+JGeosjPppWIAxNyyH2g5JSRVoUNrp9IuCNwRzBBB3ET4mTHjIi61x2UwkaqfXmr9RQGXLD+I6qI8TMeMiKcnxiYbxnNDDUxXmqe9O/YkSOJKQuRamifuAt5AaUo9E6wT03inRKCu7jUpbIg7MqdxbgioB+WU67RHn7Nh4EvyzgBPo6idyLElJO5AIJJG+VBRnuY7vFnPlWx9WKnTVfol0FUspJ0GwVsSL79Dpt+4i8oJMt3bGmX3Zmd0vJu2EMsIQnYJQlS7pt072m58CIqskLipSpUMIQpQWnUghRCdwpKhqBvyJSUK9o8IN7kDvZlrPsFCEAgrQgFvShw7KCFdQN1WB9VSSNxFIFhqUXoLiiSlI7iSLOI5c+vWxtzsNopbJuWT7P/J6k2KVEC4G19+Y+vpEp7ixzzi1jSt1Vrc/b4j8MXdwuZDFaaC5JzbkD1iL7l3mhY4dsSzWGeJt1MrNLk3ZyQcS24hekhxBC0/QCPfGv51SVXB3fR/2NkyKpox2n9pNezc71r2OK9iRhpNYqK5xLe6QvpHPoU4w5HS9Wxx3mRhmtS2Npmr0lt52TmiCosXulXUECNgoThKCUuaPExFOpGeqPJkalnEyRu1OgD9oqMv8mYLVb0ln/rH95O/6CoWpkWrek0PQyT+me+0VXsW9BIOHJcnGdGkRuGZUE/ulqJ+oRseWp+KlLtfwNazeX5WEOxfFncUggymXrQ5J0W9a19rD8EelK7ZrT5nJePplK6soIBCUggA8tjbf6DEoJXZCj6O0myfWBPxim12XjZlpQWsdvExFtwLLMqSUggJJt8dVvy9kVkXLVyPecsLGwIN7X6fhi7FltpdTclF1KTd7UPlBSAOWwsLcjcXtcRc2sW+THfJYvrlLZfmXJspZaSe0WrYgJt91z6Dl4GLbhGxKlK52Hl/TlZU5YMZz5pzc0xiqpJ7Ci09KSualW3Rqbl2Wrj9EOpGtxRI0I2UQErvh1Gl+Tii7G73LX+KnMR5alU+XkKExe7bCg5PuJT01uFbaCr9wgp8CecR9H7St1bCG/wAS+bTrh/8AWQMg8gzTmEW/0kripUIFLquxHGLeJbOJ0yuH6JjipSlZmwH3Z1CJdXzdLJWAp3R2OlSln7GhJ5kk8kmI8RC9irxkrCRTc482cbZlU+mIzErMjR2qk1Jzk2iorQJmYWtLZaOi32NrWFuFNiSNAtZUXIUKblexQ6kkjpZ3KvGk5U5CUqeabUxMTk6tkTDHbTcvJ6VqCHJpwvgMoeQEKb2UVLWEbEExVoo2MfxtR9CNsc5cTGGcupTERxGas9OTKWxKP0dtp2VJ5pmSXF9k8LboFxaxv4XHGC5BTk2rkuZGVGnZE8F+YXFbmHMqlcJTtNRLYXoiEhg1ZtDqi08UgC7ky9dLRI7rCCvkuMSs0kkubMmN7nEWDWsT44zExHnzma8mZx7jJwvstKBCKTIkgNS7YPqDQEi3RAT1JvdhDRHYlvclXTdWgj7LqKbk23tff47+wRX3FJchF+6m3q35WPUi/uP0wVgZ7WlDzJJNt7221Df2fWYhgwIAUgA2KLlOom99vD4edj5QBnSSXkk3IJAUL7g8wbe76YgGRsJDKV2ICQBe9gDpBOw6C5F/L2xIKqaKU2B3HdG9yOgNv3IHTlaAMRbSgHSkqSnUSUm5HUW8+6NzEA9VslsuJPBWUeDaLgfFeGHMWYjnpabxrPrqyVzqJVCUumSkmkgq3CSk6iLfZFWJI02pO7KkQbnnhPLTEXGxmBUcz835bCwcalvmlijU1ypuBpKC2pD5S3pbWlTJOgEkBzcxUr22RD5j2yRwvlXlzkRmFmnSceUxt/57VQ8N43xHR1qakkdm1ZQl7pIWpxaxvpJ0oBNtjDbbsSiBOK7MbBWPJ/L1jDmIGMcYjotJcl6/imVpgk2qgshBSECwBCSHTZN0oKyAecVRuiGO7NCizB+Ti4W8o6MFTNYxbP8Ap6GGFru4p0FXqnY6TNgncWKLiw3BPdsnoPzO3HSMFfKQ4OoFLxnRMuaZh7AaaX+aCu0gz0vT1OXeSUNlQBcKWWglV9rqvqiF5pJJmZeDqNmrntwv4SxXLSuNpGclJmsT2M2JVqXarjLEsF+jIQ2oqQhxTjTik7J02CSSTalOyYLsl89pzGfEfm9T3MI0GhZTZcSj/wA0zjUh6M7TOyWttSVHkjtG2nVlISjSkAbwaSSBAc3UZzhx4U8q5zLfDNPm87s35szork5KInXJFEwpDqZdlNgV6RMtpA5EhxSgbgCvaT35IHQ1dbRiX5bTLmQnOymV4Fy5manUZiyUoD8wstJUQsbABWoFFyL7kW3o5RHUiGjSWDcu+HbjDz6wjmnI5lz9dlZlC5qlyDko3T33VOFLWrUoLVqmGrKAAGkE2B2dUgiLM7cIPTOU3A1w50pK5uYnJKXnJ9thxSkqSvsEuOEBINkhcwrVzSnVfxiV1YOn5jDeEcYfKbZ1ZiYx+bHqHlPhKn0+mCrS65iVkZh1h2cdmnGlbK7JJFim3Mkd4BQp5IHJ3E7nBgrMTg5wxgCQzAkeIHN1/EaZySrOGcLqlW5NgalFhKEFRJUk6QhJUpQ7ygLBRqSs7g81qnTp2l1Wap9UkpqnVBlYbelp1hTDrJsDZSFAEHTY2I5ERcC3NMbTJU4CLC6gBvuR9FjYARJJTQA5a2hITuLdR+DuxBCKm4QhSAST9zfp0gSZQElGoEgAgnbkbbn/AMv1wIZjQFFGnSErGyr9DsPoJH+jEsqKWSp9QANjuLcwN7fQbw3RBcjUVJSNiCLEchttt9P/ABiEDMLFCE8iRa1rlAJ2+N7QIG5ivD7tfoAXTphdPr8g+iepE8ysoclZhFlJUlXMEEDcdbeAg4xkrMXsdrYYxMOK3goTiD0RmWzmwe8qVrcikBKnZsJutIHNLU4hBWnomYbIGwF8GnJ0p6Jci/Ja46lzIuy3xXSMO16cnZrBkjjpioSPoolKo4ttCGlKCnSAkXS6Up0An1O9sTtGdead1sYjSezHxifMqXruAqpRPzNmUmZrWVTi6hLKW4pSkFJdCJVBUGQgoZCCjSlatZXFakyjRvc5arSjSqxM4upzTkxKpSGcQyTAuqbl0Xs8gfrzFypJ+6TqRyMUNXW3NF244aa61L1ViWRMNvUmqrDsjMN/pYmHAFIKT+tzAItfk6E/rioi99wxwvutSskl1Teq5AQANyYlhDhYpKJ/Bs1NlKHZcJAmZR1IUlaFGxuDsoeIIiUQdFZH4ybr0srIzHU67PU6pyqm8GVJ5wrmGlNJ7Q05TijdSkJSXpZajeyFtEkBEYM4+Kkpx5P3P5P4mTF61Z8yMsWYXnMOY1qMjONJbm5WYUxNJQmyVqt2iXUftXEFLqfIlPNJjNTTVyw1Z2YkOypZnS+zZSCCsAcr9prA+BtaBSb8o4hp5CVJCkAlOg/dpCSi4vbmgFJ80pI3EUtXJHBJTZVKJU59lcCULSpXrKUjZQPnpBuDz1RHIDpZLalgKWdKHdLZJuQLkC/hzAPiCIp25EGtNgOS5CRpSUgqG9hv5xKW5UuZBOL5e5Wo3vpsdvf9e0XCOpBVSbu24nna+8Q2Xoka0SabpWe2H5x5OpgTqUPJuRdKu6frjExcNeGnH0M9HLpqGPpN/tJe3Y7HZnpBXcYrE5LpGwT2uoD4xzjyuqR26WCs+opthtwAoxFMX6agkxQ5S/ZKPovazaErMqHcr7hHm0g/ginXb9Up+i/7ivoU5/75P/5CInxv+0n6I/2jkVIWSBq3JtGw3Ro9mSlg1sPZzPpKToZDSEkDlpA/CY2/ALThI+m/xNNzSWrGy9Fl7jsSpzHoWBmgDpUEC/LY23G/18oyXz2PFZxli18uVNYULADSQTuTc9Pb+OJ2KktxhIa+yk8wBcecRYr5Coy0kAggXseYP5f8IIhu44JRpKkC+m1xa/Mk329hKQD7YrjsUm3Ly6PnBBsS2LXAHMW6n4xW0kynZ7G0ttpbyQOVk2Kfb9UU33FibOHbLljNDiSllzzTa8HYSS3UqwZi3ZTD97S0uonYpK0KcVf7hlXjFEqmiLn2ciVHobOauOl5nZ1zmJUOKXh6VDknhtonlKau9NEcg5MqHaE8+y7JPjezRjpjqlzZM3dWRFEhOzDePnWJkqbZSodkm1gRbn5xkpK1yi6THJieYpVMlZ2qKJap0vKdvMaelk3IHmTYAeJEUtuzFru5EDcnVW6c23p9HxviV/W+4lBX6AhKLqNvvZdmyQORdV+2iF+yVctyRaNSKRTqMJAy77UrLshuUZSO8QPvieZJJUo8ySTFbdlsW0rvc3VsSaJJ5MvKuB4p+xheyb9L7xF2VaUSNlPlTMZ0cQWEMrWkuS8tU0LnsUzMonvStIZI9Isoeqt9SkS6D4uKP3MQ2lu+hKQpcYuYcln58oZTcjsLhgZLZPgKqbEmB6PP1JKQjsUgWBQ0EhhI5ANueMYtNapOci49lZCCQskFYIKxfuiwG1iB7LWHkfZGTzKS8NEzFlEXUQm/MDxv5dQfLpFTfYDMgWRq0gANkE2sQDc77c/VijmAWD3rgFQT0Gytx/b+V4A10JGoBRJsu1+ZFuX1H4H2Q5AyJSS7qNroVcEqvsDY7+/f2XhcGwEq0hAtqSjTceFibEe367QsCt9iUd/QdSD0PrXJPttt5RAKKCQ6FaSACSSgbmwTY26C9r+NtjuIgD5y0xxUMrM46Tjeg0mm1GqSLL4YbqLBLd3U9mpXcUk7IKSDcc/OI2ezAz6vUJmtYrq9ZnzqnahOPTk0U8it5alL39pvub7eJidgS3lhxAY1ypwfWcMU6SouJcL1FztX6RXpJT8uHFJAWtICkkatI1JVdO17AgxS1cnkMDMrMKq5nZjfmkrFJpVFeRINyTEnRpQy8u0y2SEpCSonbWevW1toqWysQS/ROL/M/C+VeE8LU2k4acOHW2mKdVJmlqcmwyjbsrlelOpI0KUlIVpBPPeKdKJuIMtxYY2azLxziKpYNwbiRrFc1LTVRplVoy5iWbcYaSy0pu69WyE8lFQuSoWubzpVhcb2J+KvN7EmeeE8dioSFEncNdomi02nSOiRl0uAIdSpClEuBaAEm6uQFtJF4jSrWJuGZfFpmPmLl1WMIN0nDmDaHWXVO15rDlMLDlVUpSdRfcWtSjew1WsVDYki4iVFXIuzew/xlZuYZyLoeCZGVw9OOUSX9Go+IJ+nKfqMm3bQlLalL0agnuatHq7b2g4oXEt3i+zLTnpmFmA1SqCiuYrw4zQphIYdLUgw0FJQqXu5cKutS++VAnpawhpXIXIjk86sSUzghrmQsjSqazhas1QTs5UB26Z55YW2QgkOaNFmUJPc9Xz3hbe5VbYnKj8emc9HwPhGmM0XCczM0BhqXZqkxR1mamZZKdKmV/ZLISsIbClNhJOkbgxGlEJke4S4rszMEcUOPs0qXK0h2bxk4XK5RZth12nPWHdKU9prTpsoA6jsog3Bg1dWJJTwTxbYeez2pWO8xsGUCgS2CaXOu4Lw3g7DxYYmapNIDanH3CohsBKLarbFZIvaI0kLc4dxJiKr4wzAreK8QTap2t1aednZ59SibrcJWsjyHdSnwAAEVlQhKUpCNagkd+9r9QSSfj+GBFkVSklsA2uDZJVtbpv7go++J2JKHSVhRQdkX5biwtv5xAM6UfYjbqQLJO19/r39wMAYUK7yfuhsR42tcfSrV7hDZAsACet06u8SeYuL7/hg7AuBSFJDiLX9Y25XO+3jYGANhBAeBIBsTqCSTcixPuFh/omKQVRdDINh6oOi1x9zt477ecVdSDWwRjxeQ/GRRMyQVpwVX1CjY0YTsAy4saZoDoppYSsHndBH3RjHrw1R1Lmi7CWl7nRHEhh+ay5zzkq9QKbM1Wj4rW9NS3zX2Ybl5tCO0mEhSlJT2bqSJhux+6d8omlUU4L0FM4Wkc4Cr1mYc1qwnNJUbk9rVZVN/bZxUXy3ZGyiexC2yAxhdlne9l1lG/8Aotm8FzINHD1En5TB9QotTabYpqpp0yDMs8pxUlLuEL7MLKU+o5qUiw7tx4CItZkj+kZhdaw22qorSqfS6pmfLY0gTLZAWoDoFgpcHk55QSa2HUnfDuV1Qmss5Wpy2J6d2M3T1ThlElTkwhKSe4pIOxNutvLVY2qi4stOTXQa+NMJ1PClVpTNPrzSasthmqUaqSiSgyky25qZcAJ1DS4gHcC6SdrGIcYzhZ8nsVQk736nSuYk1T8ysgMv86qewJNdXlmqdXpdlPdk5oOKQUK+97GbS+z+4eR0tGHScl5L5r7/ANzKqJPykc9aE+hoaUghYGhYN+Vxa46WIIPtBjMMY0neR1Ea1qtZR2vdK03+Kx7vImBIoSk4UFp6xU4FJWSTusJIG56Ei6fPSfGI5jkxclJxQlwi90gFCSBa1gB9QSbX5A+EUsdBUL5eSsEaSSSbjlysPpiOViCMcVsgyyrJG25A9kVrkSc+1VGl10bAXPLpElyJCeIQZfEUq+LhQfSoW2tYiKWrxsVxbhNS7HcnlqZWW0rC/WAVHN2mpNPofRdOvripX5m0mfmUDZw39sRsVubcdzbbrs82RZ4/GJ0xZY1xNr800/8Arp+MNESrVAjGUl3F1OWSoixcF/jHqXOdRT1Ik7K0JnM0Ko6q5SZ1Wk+xWmN1w604eC9COf4yani6j9LOosXP9lhZITudJKhfbl7zbYGKrbmD1OOsQuFdacsTYqt0Gq1t/ripla2ERtAJv0HPbzgipivLt3eSAm/Qbcyen0RNigWZbSlaFBV1bJBIKrBQtf4k8usVLcGytwtMukJ0qTubG+myj9OyojnuRsaT84WKe7MKWkaQrTcbICT6x/0T7oPaJPU7dp9P/vQ/JVUmjrS5Tsb5nO+lVFaO6+zLzDfaHzHZyCUjyXMnrGLV8qqqfRfd/Irja1znmmtU5/ENPl6g+qlUhyZabmXmGS4qWY1ALKEDdRSi+kDwEZasndlp3tsSFmyrLWbz7rFQyqRMIwXMIbdkpeak1MLlFaAHGwFXJTqTqB/bW6RStTW5TFWbIRrjaaxjGh4dWC5LN3q9SQNwttpYRLtq8lvqSbdQ0Yp2v3FwjmvYvwdN4ldamaDiipP0156XbqdJl3EoWSoB1KVocSVp1JF7gi6fKCu97EbJWuJoxRg5Hfdp2PmALDZM1t7g6Yl37Bt2ihL4xwA2iz1Sx/IADdZRO7eJJueXOI5LkNmelOW2JpfhM+RIzF4m50TCswMwyGMEmqOqcm0SatTVMQSrcCxenCP26QeUWKjdlFFxdpxbk/g2dwRkpT01jWrFFZmPnatvOgKeU+6LpSonqkKBNzurV4xfsorSijmyT2x2Xo+17Dcc72ve30c9jtaHQFxQdJIJBCgAQLbgeHTbSPYR5xHMFoSW2thfWQEjnuCO6DziQZOxKll0kqWpAsbXuCLE+4kD23gga+lS31FIJVpudO5vz9w8vaYjruCgt2rpvp0A29ihcj3np7BBWBsOJBVZA1C9htv96Bt46SfP2WMTdJAtISlpxQcStoW73MDe49t7A+zw2iG7guWUmXHamytI1gm21lA3PnpUf2o252iOgKqK9aw4VK30qBQRfcKtbpdKUg9ByveJBiWLE6rKFwSSNiBqvfy3Fj4xAMDiFJTbUdQsLg73vb6jv53gDVWkC6dkAqAvquAeV/q9nvipPYCbMHukaTciw1dBuT9BH44hgRXFE99AsFC1zbcm9vHbz8rQBpuEEjchA76iE9Dt8TsB7IA0lpKiEgD1gEhQvz2HuEQDALae6Lg8lLFwPAkddgTbz8ImwNZwggXKiBzKlXPv6XPX+yIBpFFxz2369CBeBXYoWyULHiN9rcuvs/DAk1HASSN99rgc97WH0QBqKR91bmkWFuW9gB8CYAwBJujbUFEch15/6sAYVFKRc7thJUq/h5+38MQC8FRT9lNgFlJ3vyBv9JPvPhDmgUCje1wkm4vySD1ufr/cxUDZsTKBLZsk30oI9a9kgn4m/tPSIINZCwpQUjysRYX3v9AAPttAkwA2Gog6eY69BYfGx93nDoDIolADqBZSFgpseSr7D2936/GAM7ZHaIIICtWlKTsDckb+47+6KdwCVJsFJNk2slRG9tRsoeHICKgJldpUriDCM/R5tsFmbaUgkjcKvdJ9tyD5e+CQOj8pKjUM/vkosQZZzTzv99LLt0SUo8l3S+VsBTkg6lfMFbSXpQnwSL3vHnJeKrOL5P7/ABMnz6d+w5rGH6Y6yzMS87WXmJlpD0uHKy9fQsBSUmxG4vpPmDHo9ORiNu5vO4JkUy4U9LPuqUm+l+qzCj9LkVWViLjfnKbT6LJOVikyPoVUpakzagh5xRfaQfszR1KNwpsrHtsekRZNWF2PuQm2ZfGcyww6FsVOT7dh0clOsAG/8dhy/wD8oRTe9mT0J3l80HpWTp7MvhqlyZlGktJck1OMqdSlvs0rXY7ugXKXdikqJsSYlXSsW3G5p4gx09ienS8tN0eSlVS7bTbDssVpLYQnRsL2N0ncG++/OCbtYq023Jn4c52VxHQ81Mk6osIksQSCq7SNW4bfIRLTlvApWJN/2hZ8Yw6nkVYyXXn6v7fAyYbwaIiD7+ttU8yZeoBS2Z5m27b7ZLTyf9NtY8wRGWtnYsNCa6sd0K9U2F77kJuk8/3Q36xJSDc1pcQoWvcKO+xIF7/DbzgTzFRiZNkJSsrtpAUPEp2PtPLx5mI6BIW5V/U0Am1yLJ02vzTy+jf2+EU8h6BtYlGqRWqwF+g+r3RWSjnisoInnBfYE72tfeIfIqRCGMUaSFWIsq+8T6Spolylvh3Dki7cXUwm9vZaNBxEdNeS9J2zA1lPB05f7UKGoeMY1j0NStzMZNkE9IqRZbsty3WLc4nSU+M9IqopUvLuNvekNLUhQ7qVXJ3i7qbZrygou9xayQV2uIJh1whJW+VFQ35qPOOiRWmCXoOUzlqm36WdHY7dtQQFKPq30kHe4A67RT1LLRyPVbCoOEDcqPTzg7FxCezsqx22ty38IpXMlsVEBIGs2JBskkXHj7+u0VlIotPDWsaiEDUN7bC+3KwAvcxVdMbmKemO0DpNlJUtdgL+rYb25Dy9/jEWIuKmD8NjHmd2BcDFQbar1cl5OaUTsGCsrfPs7JDkLpO76FSVzr3ibxkqvcQiqW3oakaJIIYQ2kABD0xaYdA8AloSrfsBjDoptub6lc2uRGuAKPgOtGofmzxU9hn0Z1lTfZpSr0ptxRbIRcGykLKFqJ2Des80xmXSW6uY8tXQV8bYcwlScNUuo4WxBJzc2p1bVVpPz4zOuybhS2Ww042hIfRuu7qRa4tzBubXIoi5dTnT54MvJ4/xGhX2YzhkZJXiJVAZbA9sy84faIt7NF8edDkpWmy1NpBeKJKSZQxq1bK0CxPvVc++LqduRBu4wlX6DiOnyxJamZmVYnGmu1SoqYeQFtrsOWpJBsd/GFpX3LScZcjbk8Lz2YuMcI5W055UtUMc12WoAdQN2Jd0lc48P3Es28faRFLd+ZeSJu+UCxHI5gfKKZQcNtCbS1l5lpQEVqsSLCrISsNDsWT+5aQwix/XD4xiU/Lm5MrewxSouzyn3XNToc1LtbnqHK3UuKNh4AxklBdpCFboKLN6BqOw2V71eqTb/hEegAUOJKwbAt3sCLm+xsfZcfA+US3cB2h1tWJSEKPOxtYXuB5cj43EQwUKtEu4pN0uXJTvy02AF+vP3WJibsGJwoEwpps/Y7L2P3IAF/b5DqPbFIMCjqmlkIJcvcItclSk2AtyB5n6N4l7A3DbWohZU2olIKea7uWOnqSQBb4mwsIWBOGSWS7ubNTxBUqvXWcJYJw3KpfrlYcaC9N0k9mgXCRZKNSrkhNuSrgRQ3YlbmjmpSckqexQW8pMR1/Ey1LdRVV1mXDbJIIUHEEttklR1G26QB4xKv1IFrG2TMnhPhXyhxf86VCZxZjdQHzW4wlLDTa06goHnqPaNbKNu+eQEQnd2HQfGM8ksqsvOJtOB8T4mxdUZNvDrNQcbo9LamZ6cmlulPo7SG0nQnQlSrqHX1uV13pJ62M+aPDfh7D+dmUNAwZXKq9L47mEJVT60ygT9NbPZkuLSEggBCl3CkApU2dzYxCkLG5jLhEFP4wcCZa4Yr0/U6TWqc7UanUZlpoPU9hp3Q85ZICTfW2lAIN1KsdhBS2JsJVY4SZJ/jamMtMP4qnW8M0mgM1nE1bqrDWuUbcUuyW0oAStR0i2oWFlk3AsWra5FtzSzG4aMB/ncadj7LCp4vYDuJpWhplMW04MrqPpD6WEzUsktoWUKLiVp6KSFcrRKbvuLFlT4NnU8fVIytpi8VzGAl08TNTxY7SkIaZc7FatDbujslbhpNj3rqUN7RGra5NhuYN4ZcITMjj3HuMq3XVZWUbEUzRcPy2H5RM7WsQvMvqZIaShCk95SSAUp3N90pSSZbFh4T3BfhuZ42ME4CpOKK/LYPxDhOYr76p6Ua+c6YltSEBp0FASLqebF1JuFJUkjYGI1bC25EFA4ZQ7kRnxj7HTeKcF0fBbDrmHk1Cnok11VKe10a0vI6hLHqbEuEDe0TciwnZlcPNIwXRuHqQk6/OzeMMxWJZ2oScytkS9PS8WE3QUDWQVvmxVcEI8QYXJsSq3wdYKneMbMzAjeP60nCuBMOStUrM43INTVQmXX0OOdk022iw0oQDbQpRJAA32p1OxUNPNvIHJyQ4IMH5r5VPY3FSxHidmjUqQxSuWQp5S3HGlFbIQlSLKaVbvXvbUADcE3cClnPwQfmKx1lBhfAWJp/E9SxhWXKTOuzzTPZyDiGkuLdCWgDpS2H1qudghIvc7ypAy454L8I4d418k8p6HjWuVZrGLU7N1KovNSqfRpeXb162NKbFRINwoHYi28NW1wRll9w1YOxvxNcQGHZnFdUkcB5ays3MJq7JYcfmVS7ikgLIbLdiGnlHSLiyRubxOqwOK+0UqWQtOpJIB03ueQNh71KF4nqDMFHtt7He6RysTtt8LX8jEtgzhaTLK13sEkXSLd21/dfTYe/yiL2BqqWoEpUAVjdV+R8vYBYQ5gwlVnD13ANz3rXHhyvcfCI5MFQoFIFgEkgGyue99vDYneJ3Bcl0FZPMK5ezu8vZf6IlgqV2IBXptcair7kG3/wC0+6IugY+0sACdACQbHbz9vmf7IkDlyAxY9lx8pjQUoe9HoWYMkqkTocISlM0iy5dwjx7RCEjr31eJjDxK8lS7C9SflW7R8Y9w0zhDifxFQ2Ww3TUVQVGmt9ESs9qfSgeSHxNI8rJEZFOWqJZmrSGPVZlaq5MXVuFEA32i4WxrTzzDdRl3XFoUhR7N1JVsUnYxKuVIblFqUrI4dw69MOlaaNVW5Z5drkttvGWV8WnBFHRol3JNZqJUp1ttl58spPaFDRVpANiTbkL23PjFS3KHsLbQrKiSig1Ei5F/QHbAptq+55i4v4XHjFVmRdEh5L1+ckeMTLF6VJbXM1R+Qe6amX5N4LHxSk+1IjExC/Jd1i/S88Wcz5pUtxE5hsNKIQnEjjiABsO1YYeUB/HcWdupMXYNtLuKJecMN2eUVlZNiDcX57KBHl4/ARcKTG1NHUk35Kub73sDb3bH2wDVhclniogXJFxuL2FrAXt168+vnAbjtkELUhKCCEkgkqSQEj2fE/CKeRBqV5rTIq23IO3na/1C0SmTfY5xryNM+4Re19t+kHyLkbEJ4wSVSqiBv0ECWPzDLna4GpxXt9jsPMA840vGq2JkdWyqSnl9O/33HBptcg8usYB7em17MtUbdd/CJ5lEnbmyl0+A+MLFF0SVW6TIyGG335eXS26kiyrcoinKUppHn1IqMG0JWRCklRVqCVX3VqtY3v8Al7I6b0OON+UT9jpR+YbpQEEoULgiw25+P1RZvuQm7nJ9SA+cFbAd7w3NoP0lw0EqtYAg+O1opuVWNhL6m1nTpBG4J5j6YqKbMoZtSV8rlPI3NokqsjFMTR0JIubW5bX/ABxS3cpSJByYqSpXjKy1fKy2TUXmkG/JS5R5I+uLc29LK1zFnOuqz7fFjj1kvqSBUW3EXPRcowR9UUUPzZVPeQ1cIOGu5nYfoNSxI1hqRqNQalHarNMqeak+0UEhxaE2JSFEA25A36RlRSbsWHdIdua1PnMq+JDEWXzWJJTFi6HOIlZqoy0qpppbwSC4hKVEnuKJSTfcgxRdPkIXfM5qp+Lp5WG8PyjraHJddYS84nq5+inJg39qgL+wRSuaRXYnfBlfxJXceSkrhSlzTlfZCpxl2TmksLlQ1ZRf7VakpbCSU94qAuUjmQDeUXzLcrJbkoZj5k42xDX5CZzKlK5JGmNy8gy3Uwpxtp9Moi69R37R1sJdVub6riIaabZQtF9uZMXBhUMI1P5QsYprVTZl6fg/B770mp1J3m6g+JcrAtzRLsvAH/vIx6stMWZMFucuYIxQ9mRxCZ+531BZfn8W4vdlJFLl7Ik2nAu2rmEhPYJsOdgBCmtMCh8yVG3gG20lV1clLJCQnunUbchtt5WPjF1sg3e2UoJuU37I2Te2gfdDfmfE9CbDeCBVTv2VYJsdVh3rDdSb+XQ++IdgYm1lOlxQAQB3ioCwSBe1uZ5KJP7nyiAXhwdiAsXNiACbHc96/gN7X/bW3MSDGpw9okKVcE3JKtvNW/M90kJ8kxAMG5WUXLBBUACd0AgAfAXJ8zDdg3AsLe+wpKVLsEAE69wAkcthaxIH7UG3OJYOushcw8t5XhrzSyhzBrruDpLEaw7J1qRklvH1EtFvuJUSElpBAI0qC1C9zFtp3uiVysQFmNSME0fGDMhlzjN/G9I+b0l6rPSCpMJfUVBaEIUAQhCQ0Sd++oi/MCpXZB3BN5icNWL2ch8RYgxrO0l/Bsiw1+ZxijuqQlzSyfsqg2UhDamgVaCdQsBzsaLSXIq2GJWca5VY04sMf5lNZ7VjLCtJnEylEqUlQVvtzEimVQgqTZF760r2VyFtrnabO1iNrkl1PPnJGf4zsGYvm6/6WcH4Wm2XsRO0x1pdZnXEoQ2yltCLjSC+q5SEhTpSIizsTfcbA4msKucK2WdCma9LS+OarUWpHF9Q+a3FKpNMM0XplJUlI162whuzZPrqVYEQ07i5nw9xRZdSvG7nZPv4omaPhTFNMk5WhYmZklzBlHJWXU2HAypJISVuqKUlBupJ1CyoWdhfcjWt5jYCf4r8na1iXiPrea1DpdfcqFZcnqEqTkKalpkdgUSyGgFOKdSAohKrBVxp3JmztyA88D8WdMTxgZ0YlxZmdNpwGmTebwRRnmXzLvuAjs1JQ20dB0tg3XY/ZfG9ocdkTcRsm+I7CQ4D6Pl9WM3KjknjekTzyzWWcPioifadecdV3S24m5Lx1eooKSCLi9zjvcJjZwBnXl9gDP8Az2xrM5vVjH9ZcwezTsI1quU11U1UpoIUpwNjswlltLqWglKglJBBJJBJlptEDNrnEQqufJHV3BOK8xJvFmbFcxAkTUtOqdU8xT0vIIuvsg1ps0O4FX+yc73Am3lDoT9Vs3+E3E3E7lFm5iDMuomcw1R25KUw4mhTAYkJhIK0zDyg3sGySkpQVAqDZBITvRaRJGVM4gstMGYu4jc8aJiFmvZxYjq70hgumPS82tpinpUhpt9wqSlBSoIS7oJ1JShKABcxNnsiRbrfERlpjfHHCa3jPMNNUlcLKXXsc1WapS06akiWSGWlNNy9irtlLsWxpsnc3sYWaBZPcYGCk8LeZdSan2Xs2pzF1YawcDT3S7TJGcWltM6XCNCdDFzpCtRKUJtzMNIMC+JbJqS+Vry9xq1iozOW1By6Vh9NdakJjSH1XWVLZLYWkAAJJSlW6h0vZZ2A1ns0eHDLLgt4jcM5a5pT+M8ycapeW5ValR5mU+cO3UoFtkpQAA0289qUsp1LUTuDpDe6B5iFWmyUoKQU+ryO9rn8HkBFwFmuzaiRY7Hc7HmAPjcxG4Noq/Q6kmyCokG552BFh42F/eYO9gaSlXmFrsCdRV3jfrso+NxsB7+UTcFCrSrUkkJ16jve9gqxPuHLziGiX6C1KyHV6NyU2JtuAEgfHx8IjuIMZcBXq5BQ56uQ8Pqv9EVAwuTLaF3cWAL6lE9Od7/XaIswJ7tXlwVd5TiyqyvPne5+BhZ3BHeYFbfk6RSK/Jp9HqFIrMvOyjyT3m1pWFJIPu+MUzScGmSnZ7HdXEpU0SfEblliZ+XE4xOUBbs7K6tKZlDM8w92ZI5Ah9xI8Aoxi0PMLlTeQ3FZr5atVRa5/KdvEK1TCnHJqbel5ZcylZbJSW2GkttaOwbCdA3Dj+q+uPRcpW2MLxb7Ru4pzHy3q2Us9RRgByUqb6XgxVZeSp7LzalFtTJ+xtpsG9Cm9tyhRUSVkxOvt5f2CptO9zmJ51SMC4xSSB2c9MLSB42ac+uLL5syDq/KvEXzDnMEOVFikyM6/aanXlBPYhsqcRYqUEbqskhd0kHlcAxQ9o7FDVybanmJQKUp5+lYilK+7MU191TspOGyplp/tZZogpJCdRJ3CSoA3J2tevFtMtKMuRH2STSqlxpYAcDbTamp2enlNso0to7ORe9VNzYAuDa/WMTEtun3tfEy6S8suzJmkzWfePpltWoOYmmgLK2IbDbH/wDq+iLsF5Jbl5wxCfUsbAbi4tflb64uFNzbYJ7UJSCrUoeQPeUOXv6wJ58xxySSpdlLG6SD3wb32J23sCBvfmfdEXsOg/6c0Xd0oSkXvcAiw1beJub9bRbbKTFiJgJpKyU6bpVqv8D9J+iK48gc0YiRepPKWLd43FoqZcRCWLhaUPjzIBiEXJImHL3DqK7khSJth4ommQth0EbXSokfQoRouZVHTxjT5NI6zkMKdXK435pszz9DqFOUfSGFaOi0bgxgxqRlyPdlQlHluJJSCbkWN+UXjGaV9ylh96YXKbegf2JKuqZwjNIEm9LjSVa1gAbAxVRi1VjueTXn+Sl3MTch1fZEqBsSUjY+dvwmOlPzbHH2tyfccbUjvpsSkHvq3t1FidhziyVcjleqK/5UcuL2VdRPiRFLd2VqwkBZJuD77wJKKcUFcu6Rz84bkmBazYK3vfax/tg2wWlZN7q5ecOgFXDFV+Zs48DVor0pkcSSbqyRtpLobV9CzFDWwJf4jaeZDi9qr5HcqNHkppCj90UBcuo//wCJMWaD8lorn5xz/OVH0ZYSltTqj0T0jKvuW9jN6W5NuImXFOLcdXqWp1RK1KJ3JJ5nzieQ2I0p5Io+GvKfSn+dEULmg+RL2E61XqJiZ5dBkWau/OSLslN02apYn2J6WXpU406wQe0RdtCvIoSbi0X1qbsizPS1uOjG+Z+YuM6HK0TGc8tySlZtE1Jybkh6KmVKZcS4S03YBtGhAuhICdQvFLjK92THxfRkpcKThTmxmeAbrOG5DTb/ACszGDiPNMqna5xDlrNzctgp70eael3PT3SOzdI3Cudr26X9sZEfNRbJpp2OsUyKmime9LbbsG25hNwmwsLWtyvfl198VEWH3Tc0kXS3UqcEIKQjtGDfw3373Ie2/ugU2JFp2KaNVVgSs60VG3aIKRdJvqNybDoNt+UNxYcLbutKSLJ2BN12IGkEknpsDv0B5DqIKh1VgCboJKuzTtyGq5vuASfbZNz4RLBlQ+PS1LBKzskaSCCSCAlIHkPcN9rXikGFKz2adKrhQt3d77+HW5KvI7QBt6tUxpcuQbJVc2FgDsSfAG3W1idyRAGRStTiAbJQTdZSDuUi23UgbBKfIEwBTte1dNyVqsNRSb23AtewFtwmyRzvbncSChdStSkFd9Q7yUb7X9XwAFue/XmYgF63LghSyi/MJO4BJ2TYbbDf3+UTsC1xy6LK0tpSSNKEgBNt9I+I3JJO8AJcysKKtZTe24ueu/t8eXO4gBMfdVrNlkK6G/Lx9nTbptzMQDV2WQStKbeI2G+17X+AF+XjEgwTHcWrWSBchW+5NiSABsOnvHMxANF0qTclSU93mDe22/Tbr74AwKBsSdSVGxItbQDtYDx8ukAai+RCbjY7DexA+nwv43gDVWklSrEpHgB7D+GBKLFL03sbDfnzvArMDrh71rg9PEf8YjcGk8SkC42F7Hw+6Ps8IFewmLUSQlVr2t+FX0/ghyKWrGgtZ13KvWtfz6kef9kSQYlHkCRawKk+N77H3AD3w2BZqu4FarDVsQm/Uk7c/DzOw8YkF5c7nLYX1Am5P7UnxOq5A8hFPNA11rCb371yoXHU7Anw8fhC2wMZc5nY7Dfpsnl9N/7YnoDRmajLSyiVKF9rJA5+Q92/nzMRZ3AhzFZmHSoN3ZSvvKN9zuIh8wJinVuO63FalftjcAkk/ghckvQQRYkhPXofP43+mD5kDMzI3yonRbcOIJt0OoQe0Qd18UtxXcnQRdYwnNXPX15EfXeMah5peqeccyzayZk77ECwEZt2WRMn1pMuhJuVKUBDkgN6YRrwdivSLh+efSnzuWmx9MW3zYJbqDa30TbTSrFTygbdRqO0StkU9RfkJSSlcP8AauPJTMqFkNJO/v8ACJHM6U4W6JMznEHVMYPNlNCw/RHpV2YUnumZmlNnswfvksNLWrwC039YRh193GJep7XZC7tQXVSqqOm7lQmn55V9/wBPeW6NvYoRl8i099zCp3SCE3Gxvc+HXztf4xJQKMorS51BvcBKSoJ5Ek9CRsPAHxiEVtDupqStKUne9jY77abAX9/PYXPU2inmyESPSmEpc1nSnTb7kJA2AtfSN+XIbC1rxQxzMGKEBNMUm1jawPO17j8e3lFUSDlrEqtVScNrWPt8/wAMXHyK4kJYs/UTh5+PnEJlch95eT9ZomWsnOSDrhlZhxalp03QlQOm3wSD7407M6dOpiN+djpmQ1qtLAbK6uyXafjyTmx2FVlQgnYuIFx7xGuyw04bx3Nwp4ulN25MUH6DQq0wp+QdShZHNo/WItKrOHMznFTW6G8cDTgWQJhJF9tjF/6VHsMb6JS7WamIZgu4RnEg/wCLVz/cmPWpK1aPeajiG3Ql3P4Cfkc+lLwbUq6dN7Hpfl7eUdE6HIn2HQOMnNdJ0tjdQAOkjf2W8r+y8Ucglc5gqp/RS+RvuTtFDLqEHWNRvv5RBUC12SCFWNj13ggaqnClQHnEdQY9Vk7EWHj9UAac8lblHmwySl3sytv92O8m3vAiLIHZud9An8xcjsC5r4ZlV1NyXowdqMswgqeck30IdK0JG6i04FXSNylSiL6Yw6clTm0y5JXVzkKRdkJgomykTjQ5LZUCD5E/kYz1axZd2ZpybQ9P9q0ylhkWCG09B5+MTd9QlYinV6PR3ByMhWCT5ATF/wDVXFHKxUSth/Ek9hfFrNWplUnaNUWdSWZunza2H2woaVaVoIIuNjY7iLvaUtXFHFuNK3jOtMT+Ia/UcRTrLIZZmKpPOTLrbYJIQFLJITck28TFN7ciFFJEy8KkwEcTGK5E+pO4Xlz7eznCk/Q7GLXV4l6nzONsHNehS1dklC3o1YmWlXFrWctv8PCLkPNKB8JIKFXSkcxpUnf33uLDw5i8XdwZwbJBCLJ6EiwPx5236dInYGdo3cGkm4HdKCbi/s5crRCA+qLjGr01YbccFRYJGtl831WJIv4gG507XtvsBElOxLtJxLI1iUcUy+4HAjdpSgVi6rlSulyTe42EU8ikcHbkzgSsayuyLEquQR6oty2358rXgCjboK+6oFaki5bVcq3A0o52HTXa1tkjxgCgFaFpslCAldhbbSQdkgG/4T1O+0TyYNhC09qCs6e5YDUpJAKrAXuSE7e036k7AYFO94ALLi7IVYmydwSDtsnZPLokjlaAAL0JQNWs6kkIQLX2uDt42NvAEWHWIBIFRyqzEouYmHcHVTCM5T8T1ttK6XTVraD00khQBFlEJvpUAFEW8zeIurXBpS2XWPKlmlO4FpuEp+oYuk3FInaXJth1xgpsFaylRSkC6LkqsL2JubCdrA2MwMms0ctaLL1TGmD5rD9MmXUMszbjzLiVuLQXNF21khWlJuNraSDEJoGxlPJ5COM1udztreJZNcq62mm0zD8tcTKClWtxawkkaVAC103uPW3sd+gViacyuFultcReUWHso61Oz2H8wZJc7ILqyCpynMtpQ468olKSpHZuBYSUhYI033BFKe25Ntx1z/DhkPiHCGbeFMtsUYiq2ZuAaYZidn5txsU+cdQlZW0hIFrAtqbOkjSoDvK3uu+pNiOuG3h4yvzlwu5P4mzKnpestS7805hujS6EzEjLsrCQ++64laQF6gUjSm/QnSqxtoJHPeWUpk1NZo1Q5s12uUrBcvLOPSXzLK9rNz7gdCW2Vd1Wi7ZUokAbgi6dr1bkE155ZKZTUjhEwfnjk1Wqy5hWq1Y056n4hcs+VAuIC2klAVcLZUCCSNJChaxilO7sGjnrBWTWa2ZtEnKlgLAlRxPTZV/0eZmZMtpbQ7YKKNS1puoAgm17XF+kVXSJQlUPKXM3FGbdRwHQcD1ao4ukHFIqFMTK6FyZSQk9spRCW03I7ylAHa17iFyowZj5UZk5U1yVpuP8JzuGZuaKxIuTCEusTJQoBRbcQVIc7xT3Qb2IuLERCd2SeieDsj8vs4sIM0LFXCliLImrViVUuj4yk5la2PSg0VgvMXSphCylSghbQRayQpKiiKLtA8laxITVHxXU6NPXan5GcelJlKkFNnWlltY0ncbpOxi6NxDdUkg2vfSdIIueXM26noPwQILNSVLsCTfcXPW4BHkAAN/xQYMZcuTYgC1xYWvcne3h0A8B5wBUOWUN9rd0Aczfl8d7+UAarjqEpF1eqDuE+IsCPLb4wA25+rkvOIlT3d++d7b3sPhzhukBCUpSndSlFZvYk7338/bvEAyBV2r3vfnt+XlDcFUkXBv3L3928RYGdKja58Rcee5/D9EVdSdrDTxw0qawZLSSRdc1UZZlIHXUofSb/CKJXUWOp3HxbLUxnjgelo7voWEXgQDy1zjaPqZMY2H8wuVHeRy486QhCilShzuByjO5Fo10tuPvomJhBZlWTqKnNr26+EAaOH2Jmt0OhS1NkJusvT9SZffZpsouaWlCpgvKJS0FG1gkGLd+ZDOnKDkXnFXG0zDOB5mmNOnV2tdm2pBO5vfSslz/AMkUOpBdSpRkyb8L8KtUW+27jjGknIM2u5JYdllOveafSHwEp/dJaV5RZlX7EVqmzoXGKsNZW8G2LWcOyLNFpNMoU0JVhpRJU66js+0WtRKnHVrWkqcUSpR8gALMG51E2XXaMLI87UT8oxKsSrTqS0wylpFjcAJFvwR6Bh3LkTLTrgUFg26Abg7nx8hEkp7C9ItlSyLJJTyCj3QbdfEDck+JHkIixKH5TG++C4ClI5kqsQbEBSiQSkWubHvHoBFL3QZIdJcTqCG0qCgjdDY0bA/RtbfbrzMUdQrrc08VD/ks6je1hsmwPP8At8zFceRQcr4kAE8rY7JsdvfFfQrRCGLFD0Re/kIhFb5Ep5RVpiXy0ckZpAcZE0bAi9rpTGl5tBvEJrsR03h6olgmn+0/giRpvDlGqrJekliUfPVHL4R4sas4c9zaZUac+8aj9Hr1Dmw80VqaBuHGT+CL2qlVVmWIrEUZXg7o2RjGshIBmL223RFr6LTM/wCmr9k06m52tCmW7+s2ofQY9KD/ACiZqVZ3pNehiRko+RUUaDoISLK5W8ucdF6HJmtzpPFJQ5SL31XRuSbqtexv4ewbRadyTmurfp7ndG5ud4oZUhrOLss72HtvFPIrNUvArtbb64XQMZduojVpPI38xtEXSYLVvoCbFR2F9z02tYwb3BrGpSyQR2gIHKAO1uHDNGiI4a6dh2fqSGalQpx+UIU5ZQaLinWVDy0OWv8AtT4Rg1YvVcyYK6HliHCeSWMqs9P1vDlLdqTqipyfkXFyUysnqpbKklR8zeIjOcdkyuVNMj2qcPuW1QQpWHca16gKt3UTD7NSZ+DqUrt/Hi6q0lzLbovoyKarwp4jW3WVUXHWH636bdQamWHpBYUUBHP7InfSDzG8VqtHqUOnJDNqeSua1MlUJnsDzlT0pAW/Rn2p5BNtyA2rXbnzTF5VYS6ltxa6EeTcpMUGbLNXk5qjP3toqEq5LEf6aRFfPkU3Jl4c6qmT4zqApLiVonqFUJcaFgglHZPjl+4MWqu8GXIecQRUqeaFxI5tYfdBSJbFU0pKb27q3FKFvcRE03eBS9mKSSezG24NgLW6X9wi7uQbKLlN78+ltvy2h0INtom1xa17HkST1AGw5dYLYk30DW0lJssGwvewI6bDYDYb78thaKr2IaFaWcdafYeDjiXAdSVpVoINr3AF9Jt1vYe+DKCU6BiRU04iTniEzQGlIbbsFbclC5seRIvuSB5xFgPeUWtxZWFqW0dypN1F47DcpIvzOwsOlze0QDfKypIQBcBOk25W5BIsdh5DzHjEAp6QpUymxKgXCohKe8sja+2wG+1uQ2EVIGZISGU3Um5tYNo1AqCSb/tz3iL8ri3IRAHhlvQ04sz9wLhxTKXG6nX5ZhbWoLK0KdSHL6tj3Ervc7hChEN7A9Y5Wfyixn8qbPhFJriMxsFUhWqoiYbFL7JCAgjQlRUVgTSk95IsUnw3tbqJV1Iao8zjaocAWNsf5P0ScqmYuYGO50VGfphSZyWlPS3UN9mrulCUtpQnV9z2q1m3MTtfcnoRjxjM1TB/Dfw/5Y1Spu1OsSdPfnau5MTDrynpgIQ2VFxajrAW47a5JAAtYbRVHmyGNXh34Xp3EeG0Zt5lUWfmsv5SXM5TqBT5dT8/iHT6iUtJ3DKum4Lm3qouow5EJHRuUOO8UY2+Vaqysd4Sn8v3JDAjzOCcO1BrslyksX2gtZSO7qWEbnkNOlNwm5pa8knqRNl9QcScPnAhn3mNmTLTeGMX4vU7SKDITS0omnnF9tZ3RuElS3XXBf7hvVyIiW7tWBH3DR/6ncB/FFmVpQhxmgN0SRdKUX1raXcJKj98+1dJHeIFrmJe7SIRG/Dzws4mzsnBW6iqaw1lnIBSZirts9q9OFo2VLyje5WvYgrsUpOwC1d2JbsEhc4tsX4mcl8E5dSOXdayxyew+0pjCUlV5JbD1TU2kIXMqC97hK7AHvAOKUo6l2TESWTTw+4BpuVHC3l7nKilZg5qYsxTMmaouEcJuOsU2XfSFJQub0KCDZKP0x+6OgQbXiJPexI6prFuZ2Nfky848wsBYfelc1cS49dlcSy+HlldQkJWXcRKhlstjtFqQ02hG1jZxxxNrxFkmSPSnScnTcI8FmUOcrjGIMzVV1ysTMtVJgPzMohqUm3GkvFZKlEOLl2xcnUtojvaTEdtgYsv8W5w4e46OJfNbN1+s4dyfwxITEtIydQdUmQcS26hUr6IlVkrUW0qUXEJOpcwEkk7Q2tsDxErtZm67jOsVyeJM5UZ9+dmSsgkOPOFxWo7XIKt7C20XbAQFFXZ2SFEHYhR3O1rk9BtyHOKnYGuo6rqIC07C4NhYeHgnr4mIQMJduglRNyTcX5kgEfV9ESyUWqfCWy4fVINvO3/AB/K8U9Rca1Qn1TLykIVZgKNrH1ul/PnYRF7kCPvrUAm2w28Njb8ESxzC26+ak3/AOP039sAZAoqbN7HyP4fy3hYFwNyDfxuT7/y8NoXBmSq5urZPn+Xt28oAyU+mrxDn9lHhxA1ioYxk0LSBfupcQVk+6LVV2ptlUfOR6G55ZGYszOz7lcU0PElCplMNIbkphuqImFOMqbfdd1oS2CFhQd3BKd0iMWnVUI2L0oNyuhnU3hmwLRUB3HWaFQqawO/K0eWZprPs1r7V0j3gxXKtJ8kUqm+oraOFXAD4f8AzM0urzjRBS/W5tdRcBHX7OtSR7kiKHKrIueLiuZtTPGDgqly3oGG5FKGEjS0zTZXQgeQS2kCKHB85FaSfmjKnuLbEk0omlYQqK0nkr0XQPiqLblRj50l7TJjQry5QfsYz5ziVzYmir0XDbkvfl20y2i0UeOwq/XL30PFP/637iMcZ5lZu46w2aPVZUM0pT6HX2W5pJL+hWpCSdQGnUAojrYRchicLF31e5lEsDjJK2j3r5kZKdxVJnU7TJlCAblaAFpHn3bxlwxWHlykjDng8TTV5QYr0bGTqJ0h9dkkb3PW5jMvcwWtyZMN15maU1ZeslFxZN1OH1QkE8htqJ5Ae20U2DZJErPIM2EsLLzixezSBZBvaySR5bnYeyItYhMk3Dq0qKUWvuLW+5tfdX32xtvYbxaasSX4ydHze2lCQlKkXuDzPkfO8XI8ig5VxGv9EOb+XtsIrfIrjzIJxas9ge91+EU8yt35C5gWZUxhV9A2tOKBufBCI1jMI3r+o3nKJ6ML639hJsnVltKSW3dJ9seJKnc2uGI25j1p2KLlKJlOtPIkRiTpvoejTqxkxa9LoSu8Zdm53PcEWbVDO9ZFriythSL7kWj2U1qTNLburDcyam+wxGlsq2NwfcfPbz38DHRE/JOTy2Z1bW0JXRFG6tdgLHp16+zzihhM52rCAmaXsSL9d9vy+qLbLi5jFniUm9722Kb7GKWysQ1zWlxAJsoiwv8Al+Voos7g05mpsyyCpaiRtfff8hEvmBiVLETqp11LayEE2CR05gWiWDYp9DxVV0JdYlTLMK37WaUUXHiBzMYdTF0KezfsPRo4HE1t4xsvTsO6nYGxBKPdujEDcm8sAOGXZXuB0NyLxgSzCn+zc9OOU1V+ukOFFDxc0LtYwUCOV2VD6lRb+nU/2PeXf8KrdKnuMyF5myVvRcRMzAB5KdWj6xFaxuHfNNFp5di48mn9+4UWcwc36SQezM4lPVl0LP13i/GvhZ/rW7zFlhMZDnC/duOGR4ksa0t5Iq9LeBHVSVA/TGQoQlydzDk5Q8+LRK1H4q5OoSSZWuSLjssoAKafQHm7fuVXH0ROiS5FF6ciT8I5mZSrqqp+kUOhUWrPI0Lm5SlsS8wUnmNaUhQB6gHewvEN1LWZKhG90cbZ3ok5Tj+xJPyLoMjiOkStTaUORWEBtfL9s2bxfpPaxjzVpDaQsEWBI39VN7H8MZBbNxu+m1gkkbK0i3lYfT+OK7XI5Co0kBINyVkWSL2JHh7SfgD16LWCFFsAuJ1qCDbklWknx9YWHhsOntuSIuKLKAHiUNhIN/URuk8xY3Av+VukVd5Sb6E2aSQkBA+4B7qf7d735dbDnFIJNw7WQ8j0V1Tan0AaXCnSFgdARvfkABta9jEMDoJJ7i7HVvsqw025AjYX6kX22F94gGZLg2AWVqUUq1BQSXNRIGx5A9L2snzMTcFyn+0QtI2Hdbuba7KsABtsbXCU7AAknYbwDdpdbqdExJL1qi1SYptVlXLyk5TnS24yoAC7S+Y2JQF7esojpENAcMlmHjul4xrGIqZjKtU6t1Tu1KoS1QdbfnBsqzq0qBWTbkb3JJ6QsrAzYYzWzDwThSpUXCeN6xQKTOrUqZlZCb0IWtQCSoXvpUU81IseQJ2hZE3GjiHF2JcTIpoxJiCo15NPlxLyIqE65Mejs7fY29ROlOw2HhAgcEjnNm3SaHK0ql5oYqptNk2EsS0pK1x9tphtOwQhAVZIAsAANoiyA2ZjH2NpjM6XxpM4trExjCWUjsa07PuLnGtAITZ2+rYEgC9rEg7EiG3IktxpmPjvMSsS07jnF9SxTMy6dDBn5rUhkHnoQLITfqUgE9YJJchcRG8YYnlct6jhKVxFUpbC068H5yjtTikykw4CkhbjQOlSroTYkG2keESQKtCzdzSwphlmh4YzHxLhyjsqWpqQptaeYZbKlFSilCVAAqNybcySYjZgb+K8e41xu/JO4zxbWcVPyiFIlVVapOTXo6VG6ko1qOm5AvbnYeESTcXcM53ZuYLwC5hfCOZFfw7QHFqUJKRnyhtsqPeLZsVN3NydBTc3PPeIsmVJiZg3NjMjLup1KcwNjisYYfqCtU8qTmjpmVXvrcSsKStW57xGrnvziGlckbVZxliuuZhLxhWMTVOp4sLzbwrEzOuLmkLb3bUHb6gU2GkAjTYWtFQFnGudObGYOFJWiY3zFxBieisKQtuSqE+VNFST3XFJAAWoHkpWpXOx3MEkTyIkcJ122UBsN/D7kfj9sAaij3hfvKKrqO5v5+fM2v7YqZBpkkoJvcjx6/g8IiwMROyTz2Ntvy8YpvuBt1OduVMtqPUr8x4fhPugBLBKVc9x1A39sLE7oxWAcJtby58vr5RDZBYSNxySLkk73tAqsX6rd43IB5cuv4xE8ikuCrJttfkPy93w9sRewMhdQhBUs3sdyfPaHUBg/GchhrizwXiya0uyWHG5mfUm9gp0tqQ0m/7pST7jFqrHVHSXIWUrskXGHGLiSqPOytJcUhJNkJlUlR+MW1SSZddRdEQRUcw8x8TTh9IMz2azch+bUi491ouqCLTnJ8yYqVQaO3S5SYXSWTNONJW4XyX1BRFz3lXv8I1ariK7m1q2XYbzh8LhlTUtCu0ue45WglpAS0AygCwS2NI+iMB3e7Z6UUoqyVi82Kt97+JiFy2LiAJT4CF2LIr2aSByhcWRRKVIJKFFJ8om5FrCFWcNMVptT0shMvVEi4cSAA6PvVfj6R6eFxUqM1GTvH4HkY3ARxEHKCtNe/0Mb1Hmp2lT4ZmlpLaSUltCwoLsSL7HcDe3SNssaHa50Hh2fmJuSZS2NC1AdwL7MCw694qPsAF4puR6CcMJEMI0vlS1dpZFjpFyPDby33i3IckY8ZO2Y3AJCdrJIAPXnvy6mK48inY5WxE/edcA59bcuUVtl2JCGLHCpNr3F+oinYNNMWcLhbWFrkaSuZdV7RrsD8BGsYzfEP1G55crYSPr+I5kPqH9kYDR6upoVJadUnmq8WpRuZtKq4sUvnFNuZ+MWdLM/wCkekxoeutAsRvF+x5SGXly96HmC6zcjspxab2JsQsgGN/pO8E/QcvrLTUkuxv4nYk8tKsOtpT3u56vQX8P7ImRYTIKxAylE6tIPNR5e3+2KXvyKlsR1UQShQ23O5vFt7F1DBqD6mnF8k77j8UQBn1OaW4oguBBCdtRvcD2RNrgkzCOD5aRl0VSpMJdqLhKmm195LCb90gffEWPlGt4vFOUnTg9jbsBgowgqtRXb5ej+5Ieo32jyDYLl6Vd25+mBNyurzgSAUbXvAFSe9vAGZmVFSm25BTgb9Iu0FFOoAkWG3ttEp6Wn2FMo+MTi+pHNUyxoisWyAk3J2kyU9LIebTLzSlBokWUkar8lAi0b6opnLt1s+htzeUWKZBsuULEsvUwD3WKlL9ko+XaJuB7xBwIU7EYYqVX6fWqQrFkhM0SfkQtuVmHldtLvIWd0JdTcDfvC/n4xb06WXHLUKdMxDqLbU0bKUAQoEEKHiD+GKgPqXWh1KHkkWI9a4tuep5nl+VoqRFhYaQ4QOV1jYcir8A5eUVC4osDvgI0rQQUhAUFEi3w9vK14d5QKKUnufpbirpKQDYq9iTsBe+52PQ2iOYFRlgqVdtvWb2SWxe1uWlV9jztvsfEbRINmXdMvNpeTcPa7ktnSCevePj4gX7pPKxMAkuQqKZyQS4lztXLd5IVYEpFum6EDa19yPvRcxDAoF49qrvkruQO7oWs6R3gLEovYAbXtYADq6Axi6mwkjupB0C6iSbkkAGxsSoAkkk+O1opBmW6oO37S5GrRYkmwFtQtsSSFkb+F+QEAC1WUtIC9IT3rHcA/ci3U6QCdvHwETsDUdOgWIBcHd02sL9BzuTsLDzvEATXXe8kKtfVcEi1um2/ib+6ANVtSiwi4PeA2PPl1J67fTEgqVXF7pVfkPDr8POIBgW6LDfluOg9wgDUcX3TuUpB2PIXgDWcX3Ckm2/QwtsDRWo6LXvvbcbkwJZrrUCrUbkjqPy8oklGBbpSCT3VA7dd7QsVGuXgZhIFikmxBMQSajiyUEqFxa/LdRsOX5eMCDReUdSkciQRqHUnY+7nEqwNV1WolWxJKiAd73Nr/wBsQ2DVUodltuCbfT+XwhuBPnJkMSpO5WbgdAeQ/Lyg1cmw016lqUd7ndR8/wAukU2ZBcbXVfY3sRa+17/iEFsSYVEl4m5KuXj4QuyCwju7d0nkOVonYkrc6jew5+2G5BrTE2iWltThsOttvy8IhekmxHNdxOsMlI1WJ7jaTuqJZBpU/DUzUAJutrWhCrFEog226aiPqim11uB+02istIS3KSqGEdNCNz74kErS+DUyOATUn0fomZcS20DzFz/bETlopub6IuUo+MqxgursONISgBIvpSLD2CNGd7nS0rKxff4RBJf0HSHQF0R6CVsVv4QsTcrffaIJNhl5bE4h5o6VpNwYgm9ncQsYMNpxu4iWDDDKWElBUsqcmDzIbIF9KAoXB8Lgm9o3XA1HUwkW+a2Of5nTVLHSUeT39ov4Uca7jSkuOrUqyhZzu+03SDfz5RlnkvmdU4QSWZNAaYKhpCSlsd5XUFRAJsBtpF7xakLiVjWZUA6hWpFhsFcx4EXvYe4GLi5FJy5XXLvuKG58Qb/T1gy7Eg/Ea9dRZQLHU4B9MRYl7j1pMoW8KyI3Ci3rP8YlX4Y1SvLVXk/SbzhYOOGgvQbpKkmxEWDLuZEL22NopaKkzL2hikquKCHSFX5xFioZNNdNPzrqKTexnNabgclAK6+2N0wc9WHj3HPsfDTipr0/E7QlFCZwq2orK0hPeKdx7Tttt74zJI81MhzEiEpmjYdeg5bW+uLbK47kaVQWl1kEXI8ItuxcIrqSyuYWhQ1C/K0QuQEiSbQMSSzCyhLL6g2dXrnUQmw8t+fjaKKknGEn6GXaSUqsY9rXxOgrgKPIb8o0qz6nRyuq5iLbAqCNogF2qAK3MCq5UEiBFy9t1bMw26g2WhQUk+Y3ECVJpi9UGgqjqdbFzTp/W0evo8wO1R7gorT/ABY3TCVPGYeMuq29hz/H0vE4ycej3XcyQJFaZmksup6o3vGbzPMW2xgqFJp1Wo0zT6pJNz0i8kpWy8i6VfiPmN4dNyLXd0cU5h4Bm8s8TpnJHtZ7Bk67ZsqOpcsr71R6HqD1HnFpx0sri7m5huu9jMNNOv8AaSjybtOX2sRFSZUS/LoQuXFi4tBPNJsknrdW+5sNhuQL7daikUUM61XUbi4ClJSU3/cnkDvt1sNzygQKITsFG6QR3kpWDbwJHQbWsCefjDbkDdacbW2SVNO7WOlZbAIPLT06cyD4c9oZJnKLrClNpd1EiwK1afEW0q6eB98CBao064xUOyUtxaXlC+sKsD9ySDawG3T73Yc4WA9GyAFFGpSQLkAuJ1320353JG559L84pBkKwTZJQu3PSkaSQBa9ze34BEAuU6NDhStRSdQJ0hKTYc/cAP8ASgCwEkpWgKUELABQiyU26A353Nrkc/ZE94NbtBskXUuwNmxcXub2N+VgBz3iAaCgbJG/mL2B28L7jbptE3Bi1JQ33QAdrCwT+XP6YA1lvAKVdR533G5F+dvDbaIJSNQrUUH7lIURc+UCq1jCVAkW2HU25C/P64B7mupy+myrXF1bna45fWYFLNBxy9glN+9a1ucCDUW/pJJ3t18ff8IkkwuKCmbEkk87Hr4QKk7mEq0INiE7X1Hkn48/wxBJrOmwX9zcXOo9Olzz8OXMwBqPKJug2sdlkixHSx/EPZAGo4T2pJSAu5ttY+VvDa3uiQa61jRz+55g8xt8B4RTuBsVB8uThQPuL332J8BBkmiALjcWG1/y+PwilLtHIsOyk27oB2ANvy9sSh0LCLOb3sD06dPwxOwsWnSL6Ta2wt0ijqDE4oNi5PdCeYMVcwiOK3V0OPOLWSWUD1Qbaj4RN0QLuXOV2NscU+p4wpeFKlXaXT7lTsrKlbbRCSsk+JCUqVpTc2STawvEJOT2KHKMebJkyzyqxbmpimpUnCFNXVJ2RpExVH0pBN2mUaiBYess2SkdVECK4pOSiJSUFdipQMPh2oSrRbtrIuCNx7R0ha3MqbH/AI3LcvO0SjtbIl2y84B5bAfE/RHm4+ejDNftO3zPYyunrxWp8o7/ACGhqPIRqhvJUHe8RyQL9XIdIIFxVtEWBUK23FoMFQeo6RCKrl4UCk/VB7EmviIzC67IKShDzRkm1PgqTZsAqCHU9dYUrQroAtNwbgja8s/Rn3mlZ0//AJSf+1fFijh5jXVEtAPqbJ7xQqw8xvz+Jj12a6dXYWp600NLrrKkNqRuUoAXytbSBewt4nrGPzJsMrGroS68dIQb8r8h42+Ai6QczVtz7M6Fetcjf2xFi4iGKotU1iphlsXUV2At8IhvTG5Uk5SsupMqJQMybTIHdbbCR7haNIctUrnSowUYqPYjA4wDvaJIcdjTWwRy2ipMtuJh0r8Ikp3FDr6wiguXYxK8TK5rS80PVfYaXe3h3T9UbRl0r0bdjZp2awtidXal8jrjB04mdwHLpWtKyG9JKiN7bePs29sexI1/qNDFDAS6ra1997C2wP44tNFa2ZFlRbHZLF+Q9totsukTVRFqgo8vKITuBDdV2NZp0wLBKHxqUTbSNQO/lcD6Iia1RaLkHpmn2NE/lV1mw2vGlHSCuraAKhXe2iAXavGIaBfqtYk7RFmCurbnCwKX5GCA66WUTEpLBxXceQqmTF+Xeu5Lq9yw4j+OI9zLalpypPqrr1czXs4oqVKNdfq7P18h9ZaUeq4sxlRsE0hlL9cqNRakJJp1zQkuuL0i6jyA5k+AMbMkmtzTm7I6Cx4xlPhGgYlwJSMK1eu4tp9QEmrG07UyxLqeaURMBuUSkpDdwUpClFRG5I5RVu1dLYxYtyfnHPWJsMtVHDbtHxBILTT6jJhwNPJAUppYuhwDmk/dJJttY8jeKWujL9035PQ4IqdDncE5iT2E6molttXaSExbZ1pVylQ/LneLCVnYvp3RK+D6wXmxJTBKn2+6kggct+fT284urcMktLahdSUkK2N2hoJPO3hbn573vDqUmyiyAB2iQRqA08z7LXv0Pd6jaJauBSStxTqNSnFq30qcUO+OqkoVbbxubjpc2giTYS2VqCG21LBFrDSgEcrXHSxHT2xFiClyVErLy3EiyitsHfwJ2KVDY2v9ES+QHrTpr0qQbUpSg6gDWvUUaTayfW8tVr3vcnzNoG+tR0pSVEJuU2VbSLqBO42UbC538oWABwgFxa08iSQdhc7G45+qdh7TaAKLWVJDikly/wClqccBQTYkDlbYXUT538IdQampKmUNoOtonSkpSSNOmxUBcC5J5nw8jAGBS7lBtq1EkbAg8rm/gBtvDoDX2Swm6rDbVpVY8t9wOe/0xAE9d0uEJIB5WSnr/ZvAuIxFQ1abEIA21fluT1/FAFiiTvcK31HTyva3X3/GANdzvhQ5gHdXTnc+7lv1tbkDApdjScBNhewOw8/h7L7QIRplKdQPne1rWHMfWIBmus6lFIAtfnbY7fltEkowLKdf3xKtri5v429tucEVGqpXNV9knUN79/zPW0AajitzYb/c38fxAfXEIGsq4HPUOoO1xy+Bt74nvAnzT3ZyanNXfsLWOwJ6/l9ERewGxclwkncjw3P9kU32KlyKkW2Hgevxhu2RuYSbna/lbxv/AMImyFy2xCyEnYW3/L3/AAikblhOoA/dWsLdPyMTsBr4gn+ylywhXeUN7HkInkQRgmWereJGacwsDXdTi1JJCEDqbRR12B2LlRxE40yfy3nMMSuH5JdNM4udkZ9IcdbkX1yypZThSjdSezVfQsFIUkG/Q1LZluVNS5l+X+JKvQpVyoYLxVO0sTDQafmqPUVMl1INwlamyDz3sbbxXs5XKmk1Zkm4NkO3rb09MHWlF1KWT6x5kk+MHuUjGrM+apjqqz99TJd7FoftUf2k/CNbzKpeqoLp9pueU0tNB1H+s/cjQvzjxjYSoJiQVBuecQCoUfGAC+/lAF2o32gC4L7vOIcQJ9XLTmJAb6lSzCFNoStNkq0hLnaeJIUkjYqATuLKBjbsvjpwiv1bNGzaTljWuxJe4eeDwl2qy7ikB1JVoCkrBA+Nhf3jlyj0GeIdeUdltvCiyWijUnWU2SSoW8BfpteLC5kkHY4ndcy+QrunbbxtvawHh0Hwi8Qjm2tukhwm4vubxFmXdrEc0Nj0/M+XSRdKFaj7BvGJip6KEn6DPwUPGYqEfT8CbigKF+VzGnXszoTNVbdgSOUTcpNZbYV0iu5RY1+x3iSLGmA4eSFH2JiXYtjVxiypEpRJ4pUhTbqmVm29j3h9Rj28un5Uomu5tDyIT70TvlfUnJjDobQUk2FtXU2t9Vx8I2V8jURcxLLdxRSgXuPuPdFoL0kUz7WrXsb8htFpl8iSuMluZUod0FXOITJGjOjVJKcCihbSgsKF+h8oqBO0m/6RRpR8ndxlKjv1IF40ypHTUcexnQ6U9dKMu1I2b7c4tF67Kg7wKy7VAF2rqTzgC4K5wBXVsd4iwFqhuocn3ae6vs251vsQvl2blwptf8VaUmK4TdOoqi6blMqca1OVKXKSt8veOWTqEzJYskKyypyRmJhQUstLKFy8whVlWULFKgoEgjcbERvkZKa1R5M5nODhJwlzR2jhbNrF9VyykcIYwzBlV4VmZJxmm0WZp8o5LS4ZSSh+ZsgGwWkaUatbhBKjY96q/VmDKN9kRPmLN+nJw9PNlt2UnZNUy26qWHpC1auyWpyY0gvBRb7QA95HaFJCTtBvcrpxtc5KzuwarEOWIrMi0TWaNd5spHecZ+7T529Ye+LM1cvrY5uw9WFXlp1KhqTYOC/OxhFl46XpU0mbpbD6Ula1Ngaraid+niPLpbzi5yexbFdCjcqQdVjayFbpNvIfX0PhFSBmUL30pUsgAqSEg36i4Ceg6Hnud7Rb5gyLUSnvNpXYd65Qu3Tlb338+Yh6AZO6mYSAlaSBp+xHUpP7Wyu6d99QvbpeJs2BUo84GpxpIDaGlCwJZCm0KFx3dR25b7C/wiGgO1Cxo1oIDah3dIIBT4kAG3jYHe+8UsFnaWCiVKbB5rSCnkLdTsd1befnAFmsK1mw1kWUtKgpSQe7bfc7A9PadoAsccvNHUpYWVgELIKgATtvtzI5C0QwaxWO7YaiQLm4uNttvqiAYnF3330p2IvYDe9ieXmfZ5wBourBBIOqw9bZIPPl5c/ogSjU1G+mwQABchPIf2/GBWCj3u/c/ujew8/M8z8IFLZruLSACTsBsCee3Xbc73gUmstRC1KPMmxURsPLzPPbkIA1Cq1zcg2O53P/AB3/ACtEg1nFAE76RqJuRyFug6xBUtjXUSCSDp2Hu2uSfdAqNN0kIVYHYXsN+f4dxEW3BpukXPdv0BBv+XK3uiQa6z3tPdsD47DzMRuBvVJ27yWxvpF9vPx/LkInlsBNB28fG3M263il8wV8rDw9psPjDckx/dK333sb8vf484Ngwm/aDa1+flBWFzC8sNS6lGwCRa5he4ZFdane0W64TYHugeAHOJbIFTBUiGKI7VHRZ6dVZu43DYO3xO/uihJ2uCaKHTn1tdslpegAKJSk8uhvaLiuyLoXzhOjz8z6Ywh2lVb7mepznYvE/trd1fsUDDmQ7j6VMY3wPl66JldOxJITYDTUym8rPMqVsNaN23B5pKT5RS2oJyfQqjFzkormxost9jKttatRSNz4nmT8Y0mpN1Jub6nR6VNUqaguhlvbeLfMvXK33gTcLi23OBF2XDcjexgVXKE2O+8BdBqgQmZGx2j7bYUAVKCbnlziHyJ57CTPLUvF1Qmg4XmVOWaShYDjRSAnfayipOkhX3ukdI3mhB06MI+g5ziqiq4qc+1slbAzMu5PMOTbitenuKVtcb735n2XPXaLjMM6UMyGcJLLLgDJQQNIIIP7Yg23PleKEkQc64ym+0feKbgn2nx+j6IrJXM5+r8wNDluVri4HjzikubCRl9Ll3EVRnVDZCNKT5k/ijyMxlako9rPfyiF68pdi+JLQ62jWeZuhapIULRO6KbGsWbGKrplNrGPs1eMXNiLGl85zYOywn2JERpRb1SEPEiXKpgSopWe0dYSH2z17hufovGdhJeLxEX27HnY6HjcLJdVv7BWyoqxRNts6+6q3dJIv4EW5EG2/sjdVujnsrrcneuJadlEm9iUk2S9fe2+w3PXf6otrmUvkRBUGymYOkbW8LRbki+iMsRypKlLCSQL7xa5FxkerG6kEiytre2KyCTsHzRfwLLpcKe1ZWtlYTyFlG1vKxEavjI6a7fbubpl89WFS7Nhz8xHnnqFb7HeBJWAvsF4E3K3gTcqFQJL0rKVAg2INxAhj2LqZ9kL1d+opLyP2k20kBwfx0aV+0KjZMtrOVJ0useXd/Y1POKOmqq65T596+Y6qNNmepjaUpu6DYgC5JEe3sa2xMrWLaFRKoimvTDtQrjv6RSKayZmbcJ/7tPq+1VhFDkmxshBfl8bYjZdbnX2sAUldwqWlCibqbqTzCl/pTFx0GpQhZsX22OSMU4fTgPO6doLZdNImEpdkVuq1KU2obXPUg3BNukWvNlYrTbRLGAaorsnKa5ptvbUTb2kHY/XF9PYhqxK5b1IaSO+ASlOlJO3IgX5EG3LptEpJkAUnsk6m+7pukFPcIO4ItYHrYk9CSLRHeACyWNlFJB7uhy6R15EWA8ee535wsgVAC2gnQU7aUpKCB/Fttfl5EnkNoot1BeHl/Y1h4i5+xKC7EKHMC2+/kd77xUB6y82JqWafW4nWr1tZ0qvexBJBPPYX8IiSBsFZJugaSdgvsydF+dircnluPoimwLHHV7JCy6QNiFa1XBv02HQeAAMGDTKhdIUhYQSCUkg8rmwvzuoczytfpEbA1y6suhKgXFXCjciyrmwA6Ac9ySbAm0Aaipm8unQEmxBbUD0PUDlvtbrYQ5gwrfWu5K9XduLX62ub+WwueZ3iAYytLYRewIN7b+I/ABAFupRHqjWQRZXXY7m/sETYGJRBWm+6fVAB9a99/fb4C8Aai7mx0jUoEnxTfkPftEAwL6JbuL7Ajnbw+F72gDE4DYWTvyAH5f2fCBUjWXYoJ7yiT08z9Z2G/S5gSlY0XDYFR9bc3Sfb9XifdFSJNNd7FIAFk2GnoALGD2BouL0NgqIAG5JPI7xSyRquuFx5Sz90bjflEd5BagnmTbfpuekOYL0j228OVtx/wAIi3YStjHzWs+4EDkOZiHsS+RiUCV3OwJ6ROxSN7EE2GKcUcioEDp74noCJpsO1GsytNYJK33A2PIdTFD35A6Xy+wBOY6x5K4Xo8zKyBbk1uJcmlFLYQgAW26nULRWuwpk9Kueo9CouM3sNy2GVSOH3G5ViVRNqTPzSe1bMqpCgdLIGhKFAi1iFKHPnF2No2Rgaru5yRNYEl6Bi2lCVqiKhLz7Uw96OiVcbMmhmaclghS3N1q1NL3sNgD1hJNbmVGTa3GfjqppnMVM05lV5WRQCrwLh/EN/hHjY+rppKmub+BsmVUNdV1Xyj8f7DOuLc7RrVjbw1bRFmChVuN9oWBW4HLlDYFQd/LpEbAqVWTAFAeUAZkPIlyqYdIS00krUSSALct+m5EXqUHUqRgurLFaoqVGU30QgSjTxSoOtqS+XD6S2pW5XvdSjc3UeZI2JvaN7ObK507lvR2uzZmEyzbAsO8lWgH2qB5Hnc35RYk2gSZid5lqmDQwlpwDSLaVE2/bAXt7SIK4OW8UzYUVpvcm55k/R/ZFRUiCMRTVmXN738YjcrHLgWX9HwcXiNKn3iq9uYGw/DGs5hO9VR7F8Tccphpw7l2v4D3SraPJszYLmUG4MRzJvcoRccoWYaMeneKiLDUCjaLtrGHczyxQqZ7JwXbdSUKHiCLGCbTuiVaWzGPhR1yj46XJLX3paZU2b3AIBt033Eb1RnrgpLqjnFem6dRw7GdctKRN4eSoPFzuDYvjpyJsm/x3PWLrVmY1nYi6uMFqpLQk37xvsr8POLL5F2O6GFWmNdPdFhuNriLJe5oiKaaLcwRvblytFzmUjjwRM9lWqpIL7napTMISbbkd1VvdaPGzCF4xn6jYcrqWlKHbuSQDHgGzlbwBW5MAVvtAFbwBWACBUjZXX5KiYQqb9SnEyTLKRNSz6wT2cw3u2ABudW6CB0UYysLKpHERcN/l1MPGKlPCTjUdlzT9PT2mSSFVxCxT6m7WzSMPVVntjJUJ7S4Seba5lQ1Jt1CAPbG5fA56SjRqJSKFRvQ6JTmKZLuH7ImXSdbx++cWSVuHzUoxJAomydtNk+yKr3IW3M5+z/w4qoZcSeIJZq87R3brUBuplZAPuSqx95i1NbXKouzIhwpVEl2nT6VaQbIcsdwR/bExZW9zplktzEgw8lSR2g3Ugm3IcwTY28B4xcukW9zO42i4VpKVKNxc943PMWPeF7XG1vYDEWvsSYlIc16VqIUobhRKrnna1/Yd+fnFIMSbJBKm1ab3uUoUefMk3vz53sb7QBkBKUkoWdJGk2VsrbkRsAB7TtC1wLlImtKnmSogaiUBCwhB2sRqTcq53Onbz3gBbUb6ADdFrGwOmwHTfl7tzeKbsGNS1qKUrQs6jclwDvAX5A7gbgfhibA1FEJVpAcCrnUAoI/a87k9bW8zBg1SpJQokEt31EAkJ2Ht8NI98R6QYVKVcgXU5fVbz3JPha1vcIpBYXNioG99k7b78rW6mwgDGSCuwIUrlqtsD5b8hvb8MAYkkWBAIFkmyel7299gT74lAFLOhQ2STsEjpsNgeu3MjyHIQBrFSSsAjUOfl47+V/qiCq1tyz1TvYlIuT472uffsB06c4EM11Agq1WI3Ok8/f8Ai84C5ruKIBJSRfpbY9bwJRoO7bKRsbX38vy9kAjUdN1HluSb8gfytE8yoQ6g5aUIA3UeV/bEN2AgFIKjuCOd7eEU36EmTTZHs259eX4foiWQXJT+19x/D9EUgtsNarbDpvB+glsssm6TbTYb2iCCNMUTeqfUkG4SN94r6AQMJSs09XpmrNMImUyyS0lCnNCipQ3KSRa4Hj4xQt2CYqDUpU1Rpl1xymThIAZmLtKVvySb2VuByJitcyp2aJmTNVl5lKHaxPq5Gyp507j1fuulzbwiu5ZVh/yAYwvgCerEypS3ikq1uqJUtR8zz3MOZPNkOMJUljU4pS3XFFxwrUSdSjc7nwvaNPxNXx1Zy9ncdCwlHxFCMPb3mQr3jFM0qVW9sAVC+9y6QBRTgB84gh7FA5v0+MLEXKhwc4km6Lg4LRS0SWTTgFK0qW60Jh4MFbRssBST6p5X5c/udXW0exl9PVWc+xfE8LNaunDqmucn7l90b1DkQ7PtNtNhCQQTp5bD4jl09kbI2aYdiYCpqJSjB1aOzcIPf3BO9+fI8+ftiy27gRccz/2V0IVqsO7ZV7Dl15e6LiIvc5VxFMkzDxB7tz0222EGXFyIRrj5en0sp31Kta0RukVExU5gSlCk5Yf4tpI99t40uvPxlaUvSdEw0PE0Iw7Eb4XYeMWDK5mdDlzzgVGwndW3OIuVIu0K8BC5Iy+R3N4v3MC1i5J0qChzBvEdSbjRxM0ZDMCUqTYs3OtBSvDWmwP0aTGy5fU1UtL6Gp5rS011NfrL3nSeDar6dhNKGl3KUi6rpUdNtuvdtv06R7bNbb6CfiCTSHisq1925I9v/GLT3K4qyI8nmAtlabW2sRbrFl2L5EVYlS3OOBI31XsfD2xK5ARZCa+bsVSE6V6G23tDo8UK2P1gxjYimqlKUTLw1TxNeM/vYmgGx9kakb6Xg9Sd4gFb726wBW/jABABAF4NxAEHZtTswa1RZAqKZLs1ulI5KXe1z7B9ce5gIx0uXU1jNZS1xj05+seOTeJhMSkzguddAKyX6Yon1Vj1kD2x70HdWNbex11l5OYbmsYSEvi4uilAlDoQopAWSAkuEEENjcqIN9hzi6u0tTvbY6HmMKZfYsw5PtYflZJublnUpQ/hdqamnEg7pSppa1dopdlBIA1E7kJSCYlbmM5SjzOYsUUhqclapSJunTchT5xtxtEvPoIdS0q6QVEpAJG1yBa4ilpvYvxlc4BoTT9HxZWsNzZKH5V9SU36KSbXHtsDFiOzsZJ1Tgye+ccEJSpQ7RtOlRUR3QOR9x5XHPzi+97FI7FaNNl6dJ+6Vbn4EK3677e7cxD23IMCmdDd0hSW72IsEpHt2B8CPHxF4hkGvqCCDcWUCUkXSpV9tSgD5Wtb2i+8GiS09ipsKI7UkWQXe+o+QCjblsNr7RIMso4GJ4LvZIsDqAAI8FaRcey+4vcGKUB0lxGkrJCSeQUqwGw3t47gAH2gQBabB0pSvtFXsClItfz3soC/PnccusUg1lLuQdkoAGlCEnYb8gB59YO4NfSreydIFz30gHbfl7Tz9lhAFitlgCwSRclXNQ33tfyUSSfxQ6Aw3sTyv5b3vt9A295iAY+Vwu1ydrqsD5C3nteABRAPdPlsm4HS2/Ppt7BygDCbkE/dEXVY8z1F/dEvYlblAkBu172NypI59bfV9AiCDEvUlvc2tc35nqTv1PPfpAk1SU7hXdsTtbzvc+MLMmxrLVZKddyPuh1HiPw+URclI03rqSQR3utuV7xJInujfZXPfYchz2/LpDkSNqeVrnNI2A3P4Yh2Y5mkE3selt7nn+VoCxcCL8uQ+H4opfaQZUgX2HPlvEAxaR7CR0O/5WiSTWmFhuXcXvsk7DpEDoQnXZpKnH3L+ssknpYcoqZA+8IyJk8FSSFDS68C+543VuPotELmCZJLC9QmcHoqE9QZl6gOEJEzMSCzKruSAAsp03JBAseYi4k2tilyje1xxYdwhUVVRH5nawunNIF/Q59BmpM+Vie0bH7hXuiCGNLNfNCo05MnQZmjy7E9KOBUw1LzvbS0wAeaVWChfwUkEecU1Y3puN7XL1KXi5qdr26F9HrEpXcNytUklEsPJvpV6yFDZST5gxp1Sm6U3FnQaNaNampx6ilFovXCBCdio+mBVcwlV3T5bCBQVvAFdXhAFb7c4A1py/z1Lti1mGTq53WVlKh5FO23XUkxtOApqOHu+u/yNNzOqqmJ0rlHb19ST8ESRen+053A3SLgbnwH5Wj0ZPc8U6zpoap2FQUrCFH1lIcIvseY67bxZW7IINxvVC4Zghdje25vpi6Sc1V+astaioXiG7lwjeksGo4+l0HdCF6lX8t4xcRPxdFyMzC0/G4iMfSTNffwjTToBXULbwBcldh3ecCUzbaduodT0iC4mbfajwiLFW4xr7+UZRgFb77wBo4jlfTsvnHUJ1TEi4HkW56Rsr6D9EZuDn4vEJdHsefj6XjcK2lvHf5joyyrG7bC3O5y0ldgbm4G9+Z8uftjcFyNCkS/V2A5Ti7YjUb6lC1tuo0jrt9UUPmE7EYzbOh5YII33uLGLEluX0yNsQyRWouAb+NrdYj0FRGs4hJ7RBGyhpN9oqBKeHqh84YUlXVrvMISG3wTchQ8fdY++NUxNLxdVrobzg6vjsOn1WzFsGwjCM8u1b+UAVvtvAFQTeAKg/GALoAiXNimqewxI1NAJVKP6V7ckr2v8QPjHrYCdpuPaeDmlPVTU+z7SGqfPzNNqktPyjpZmWFhxpY5hQMe9exqp3BhvErOIcLSOJpEhtTo7OeaT/ingLE28DzjIT2uW/Qdo5ZY6wjT6JK1B/GFVyyrNOng1SXKFNvBaZdbbfbuuaUKS846vtAtSwbAIAASkRe5oxJRncQM16hl7W8HmfkMysR45xjL6ES8xXXXXA4wSNSLrQOzKVFaktgkWJOo7JiPUUQVRM8xs2pH5l4gqdWWxpaqbCVuEbArSdC/qB98Y0tpXM+L2JMyym1JrUxJkqBO6dFib+Xj/aYuK4ZMi21hZtaw2B7TTp6kG1yLcxvy5wsyDWWNGpTiGwAkn1rHSdz8eQ73j7IkGs4ypUuVtIuq4KyW9YO2xNh7Po5wuDSAcbdWlYUFC5AULK89+vhz5naIBRwd/StHZOXISUpCSB1FrEnpve/luYWYF2TmFLkkIK7LTdKlJFzb2/j3iAZSoqSodqoggX0kEWG5sb2AG3tiLgsKhYnVqAF0koJJtY7X5dNzzO/S0RYGIEaCLpUoqBSBawHMCx3O5AHjYxLYMblj3UpWATcpJ3JvbdXWw68r8uUUgsUoloKWbXUdr7c72t7AIAogEHSLg23IB1BNuV/HlAFt9jyRawBta3s8vrJgC3TuDsUjr0Fzf8P0ecAYlG6AR0SNAG3K4/H74m9wa6rEH7odAB7togqRjWRzN7g+3/iYkLmaa9rKULWVcW+H5HwiCTTc2Fr+QAFjYfVDe5JoTBCQVKNvG3xiANZYK3FkcieZil3JMZF0Ag/ExJLL0otsLBJPI9fy2h0IK2OyhzPLf2CKdyHzLdHID49YlpE7CLXnPR6C8onex5fl+V4DYgqopM1UJWTHN99LfLxO8RIgnWUQEuIbTshNkp8gNh9UNyTo9jM7FtW4XsNZQTE32mFKRWnqlKNBRKitxGlLauhQhRcWkdC4fARdi7Ra7S04LVqN2q1aTwJlPMz8wsNzK2ja535RK7SUeelerMzXMTTlUm1EuPLKhc8h0EWm7u5Uiest5N+Rynku2ulUy6uYSk9EqPd+gX98axi5KVd26bG65fBwwyv13H3fbz8YwT1ABtzgA1jSSeUAYAo8+sAXXsIAAtXS0S0DI0UduFPHSynvOKJ2CRuTFUIOclFdS3Oapwc3ySuJtMUqZnlOq77rzyiruAFW9k3A2vbTysNvON4S0xUVyOdybnJyfU6ey6oy20sqUkFSiCU6TuANvAjn4+MW2W2S5iCb7GjFKl6XAnSQbeHW+45C+56QSsDmXFlRClOJv3BsOm39sSSjnvEU4brBIVt1PWKdyspgeVsqan1jvK7qb9Lx4+YVLQUDYsqp3nKp2bEhhYJjwTaiuraIsCqVRDQMiV2N4iwNvtjbnFFiq40oyjFK3uYA35FSDMLYdTqadSUqT4g7W+EQ207orjZ+S+TGTQnHMP46mae6sgMuEJ32Wg7j3EWjdqFVVYKXac8xNF0akqb6HTcpONz9BS4lClKCAO0csCB7bWPgLeHSL7VmYCvyGhVGiHF2To5nfY8+fti3K1i8t0MSpyZWwsWuSNr9Nosu9y9zREVVk1tuuKtYA3vE3INjBVR7GuzVOWqzb47RsG/rDbbpaPLx1PXT1roe3ltbRV8W+T+JKAPXrHgG2Jlb7eUQLorfbnENElQrnEWYK6vrhZgvCvOIAl1qnNVfDE7TnfUmGSi9uRPI+42MXac3TmpdhYrU1VpOD6nJKm3ZeZeln06XmllCx4EGxjbk01dHP2nF2ZKGV+NRhfFypOeVqotQs3MpJ2Qei/dFyLtsUs6/k5syzwlVr1sqGplxJuFpO4IMX0W3ub7zhUbDlbqecVLkQ+Rz3n7JtPYMw9PW+yMVFTV+ulaL2+KYszKomrla6XsV029lIflwCFKsFHz6RWmrXKmdSvSRVzTpUkC29ym24vfl477RG/MpExyVWFEDRcm6Si6jfxBGxN9zz/BE7Ng1PR0doFqS2Ra9zuQOYtpKee+99ufIROwMKpFB9QNpG1iguDpt3d/b7vCId2wJz0sptFwoFVtwE2tfbr13POw22J5Qv0BbIrAdUgghCx3QFaQTa53uCNudh5DxinkBQ7UKaWqzbgvuACU6uiUpIA2vz35xHUFhWSkgm4vuo37xvc+0D6bCDQManQEk3uNR1XsoePx+IA9sUgsCisDUpAIsLny5D3Wvt4RLBnWChoEAW0m1rEWG51HrbbYddt4AsUe6obFOohRKudrfRc84gFASpRPqnVpOgWJJ5AHp+CAKLP3RVZVrjy9nkNh5mAMK07lIsLKI3FwALbW9/wBESwYVDSnYkm29xy3/AC/IRANVarrG1+9bbbxsB5wKkzWO6SDYk2FwfoH4YFRqrN1G43O42vcn8Nx7Ii4EyeVpZIFiCru+/f6gfoib9AN0IukA+/z8ooe+wDRfUSOZ9n5eECrmFipJ6j/hFXQpLtPeSOQJNyPdEXsyqxkDdwdiATf8vjDmQNfFyLYfXYWG3TkIkEMMW/NvSVKAKRPJuT9EUEE204apgXtzisE8YNpzLcsuqToCJZlOq58orXMpbOas5swnMT4wcpco7emyyrHSdlEdPdFMn0RKIlodKXXcWSNLQe6+4O1P3qBuo/CMWrNU6bkzJoUnWqqC6nWbSEMy7bLSQhptAShI+5AFgI1Jtt3Zv6SiklyRkuIgkpeALHFdwAdYlcyDHfaK7kX3C+1vwRHUlgL6vAwsEjXqkyuSw4SkupfnCpprskG+gDvnUOXNItzIKrR62X0tVRzfJfFnhZnW0UlTXOXwQ5sA0f5wqiHm0pdaQbHSLpRbofDl1jY5NNWNRO08PSAk6Yw400lkHci4GoC+1vHmb+EWupAzcX1QpStomx+5Uq3gU36+JNvxxJJzFiWf7R1xd7p33O4/42tE2K0QbW5hT02GRe6jaIJJIosoJPDUs1ayinWq/O5/stGp4qp4yu2uRveCpeJw8U+b3frFcncRhnoXRS5vAku1bDeAMgV5xAMuvblEWA3b+G8XjHKg7iAL0LKHUrHMG8AI2Mpbs36bX5cXvZiYty8UH6x8I9nLq27pvvR4GbUbqNaPc/sJRwFUTNyKW1BJX2d0kqsbddxcmx6gC3WNkfI1G249apR33GS8lBDXOwVqOrl4DfpvFplS25jGqUoENloAKUR9Pj5RQy5Ei2vU1DEm4+84lpkk+soDe1/bEFZEUy65KVuXmmUlpLLmpK1ixI8hz98UtJppkpuMlJc0TfTp5qo0eXnG/VcRcp+9PURqVWm6VRwZvlGqq1JTXU3d7+UWi+F+QtAFQbmAL7jxgV3QA7RGyJKk90iJIZzpmTSfm/Hiag0jTLT6NSiOXaDZXx2Pxj38JU1U9L6Gn5hS8XW1LlL4jBCo9E8g6Qytxump01jClXmwzNs/83TK/uh+tkxfjK6sUNdh0CxMHUqWeT2byNlC994uop9DIGz4qKEYZoNMJ+yuzS5kpvyShOkH4qi1UZMUugr5NUl1eMqK2U3LMklbnkSLj6YlLbcqZ14/JjsbpTqKTsUpshPjudib23sYgpEiYkllvvIKx7dvG+9vptDqBJdlSlKVWsgAndSdr9dhYE8t/HpB7A1DL2bASVONja19/MCxt9FtzeJAnTbBLSrEqaINtA2BsdrHn12B3v74gDafaUy9rI1HYFZIvYdFK6i/Tp1hyBmU6u2pxRJSm6Qbk228enK+9ohAx6glKTpB67/Sdtt7eW0QCi1LtdR7xHO30bwBe2ShJI7p2Tsb28/efqiAZy4lTWwAFuWna1/hYD29YAvCjZQBIJPe29Xw+vlzgC0qSltJG1k2QCeVxz+v3wBYhd3BoG5Nu6Lb/g6wBRx0JSCkXsLBV7/kOl+sAJ61XSfM9d7wJszConSQDbnbxJv095gVIxLI0C5ASCBYb7X/AOEESYCgkWAsbAc/hEgQp7vqQlNrAg2t16D2CKeQRohA0b3FgLePsiFzABu4uBsLfAHn+CI3BiQ2bDSOQ+rb8UTyZOxnDdgduQ2iHu9hsZ0ti1zt4DkbfleF3yJVuojYhklTOHJkBNzoJtEhnOFQ7VirJKO64qy27/foPKIZSTjhmaZqbks62uzTqQo3+58R7jeJQFzMzMhFMwmjDVEcCXVIstafuR4nzittJbFNtzlhS1FRUo3JNyTzMWiom/KyilmnTNefT9kmPsUsT0bB7x952/ix4eOq3aguhs+WUbRdV9eRL99/CPHNhKXuIAPiYApsSPAQBddPVIMAH2O/qkHyieQL22kuvIQFaLndSjYJHiT4CJV27IhtJXfI02R871szIbKJVGlqWQD9ykW1GxsVHfcbWt79yoUvE0lFdPiaBiazxFdzfq7ifcKYIlZkszqVTNNqKUd2fkHezctzAUD3Vp66SPGLrZhknvT2I8N00oqMm3iKUbbB+cKQ2GZm99u0lD3VADfU2q/PaIt2AibEWI5SppfVKzSZhDatDosUqSq26VJUAQdzzECdyCsQzujtNRuN7G30we5WR1Spf5zxghKt2W+8vyA/L6YxMRV8VSbM3CUfH11HpzfcSte3MRqRvYXgC6+8AECblyTYwKky6BIiDr7IuGOVHMeyALuo9sAWYh/wVTP7pv8A1xGZgP0j2mHmP6G/ULWV/wDzon90mNyfI0CXM6JxN6sp/kUf6yotMqfIieb/AEw/uBFuRVHkQvjX/pdTv3cQVkaYi/5/mv3R+uD5AfeB/wDoIx7R/qiNcxv51dxtuXfo/rHmPVEeceuHUQBRPKAZcOZ9kAV+6EUvmVIr1VFRL5ES5s/9Eab/APGn/UMergfPl3Gv5p+bj3kH9I9s1gWaB/0xpn/xCfriqPMpZ3ZO/wDPMt/kU/VGUi2zmXPf/CLR/wB6h/OGLNQqiT/kp/hBm/3sR/8Api4VM6Ye/VKP8j+CKCgb8z+qV/5Rn6zEdSTX/wAbP/5VX1iK3yHU1HPWc/yA/DBAbs/+qHP/AIkf6qYgMbc5+p/4giAaCPVZ/dq+pMUoF5/VA931CIBc/wDpw/y34YDqXJ9Vj9z+AwBtMfqlfvgC1f6mZ9p/1jAGN713v4v+rAFrf6Sr9wr6jAGF/mn9yj/9UCVzMDXJv92mBPU1h67fs/AYBGNXJH7kfUIkq6l7n6qV7ogDbd/Viv3KfqMUSBiX6vx+oRH6rIKK/Uw/yY+uK1yJKfd/D64dSSqP033n8EUrmQbSfXH7s/WYnqXGa1R/5rd/yZiHyCOZa/8A8+S//wASuJZbH9l7/wAwuf5Zz64qXIkjzFn/AE+nP3cUsgbXT3xSDqTBP+C2if8Awg+sxrGK/PSN4wP6LDuHWrpGEegWwBcPUMECg6+yJYKnmfZEAoP02KnyBnR+oah/8C//ADaoycN+ej3owsZ+jT7n8DYof6ip3/ww+pMbkuRz98zrPA/6RK+0fWqLbJHFi3/mof5M/XEEHLGO/wDCQ1+7V/NwRWiKcRfqVf5eECobmDf+kNQ/cfhEeVj/AM0u89rLP0h9xIZ5mNbRtwRIDpAFR6wgC+BK5l45CBWf/9k=